Bacterial Infections

Staphylococcus aureus bacteraemia: a major cause of mortality in Australia and New Zealand.

2009-10-17T06:10:00.000-07:00

Staphylococcus aureus bacteraemia: a major cause of mortality in Australia and New Zealand.

Med J Aust. 2009 Oct 5

Turnidge JD, Kotsanas D, Munckhof W, Roberts S, Bennett CM, Nimmo GR, Coombs GW,Murray RJ, Howden B, Johnson PD, Dowling K; The Australia New Zealand Cooperative on Outcomes in Staphylococcal Sepsis.

Women's and Children's Hospital, Adelaide, SA, Australia. john.turnidge@health.sa.gov.au.

OBJECTIVE:

To document the types of, and mortality from, Staphylococcus aureus bacteraemia in Australia and New Zealand, and determine factors associated with mortality.

DESIGN AND SETTING:

Prospective observational study in 27 independent or hospital pathology laboratories in Australia (24) and New Zealand (3), employing a web-based database to prospectively record demographic features, selected risk factors, principal antibiotic treatment and mortality data on all patients with positive blood cultures for S. aureus from June 2007 to May 2008.

MAIN OUTCOME MEASURE:

30-day all-cause mortality.

RESULTS:

1994 episodes of S. aureus bacteraemia were identified, and complete 30-day follow-up data were available for 1865. Most episodes had their onset in the community (60.8%; 95% CI, 58.7%-63.0%). Methicillin-resistant S. aureus (MRSA) caused 450 episodes (24.1%; 95% CI, 22.2%-25.9%), and 123 of these (27.3%) had a susceptibility profile consistent with community-associated MRSA. All-cause mortality at 30 days was 20.6% (95% CI, 18.8%-22.5%). On univariate analysis, increased mortality was significantly associated with older age, European ethnicity, MRSA infection, infections not originating from a medical device, sepsis syndrome, pneumonia/empyema, and treatment with a glycopeptide or other non-beta-lactam antibiotic. On multivariable analysis, independent predictors of mortality were age, sepsis syndrome, pneumonia/empyema, device-associated infection with a secondary focus, left-sided endocarditis, and treatment with a glycopeptide such as vancomycin, but not MRSA infection.

CONCLUSIONS:

S. aureus bacteraemia is a common infection in both the community and hospitals in Australia and New Zealand, and is associated with appreciable mortality. Invasive MRSA infection may be more life-threatening, partly because of the inferior efficacy of the standard treatment, vancomycin. National web-based surveillance of S. aureus bacteraemia and its outcomes is not only important but also easily achievable.

eMedical Journal of Australia

Emerging Infections in Burns

2009-10-11T07:59:00.000-07:00

Emerging Infections in Burns

Surg Infect (Larchmt). 2009 Oct 7

Ludwik K. Branski,^*

^*These authors contributed equally to this work.

Ahmed Al-Mousawi,^*

Haidy Rivero,^*

Marc G. Jeschke,

Arthur P. Sanford, and

David N. Herndon

Department of Surgery, The University of Texas Medical Branch and Shriners Hospitals

for Children, Galveston, Texas.

Address correspondence to:

Dr. David N. Herndon - Shriners Hospitals for Children - 815 Market St.

Galveston, TX 77550

Abstract Background:

Patients who suffer severe burns are at higher risk for local

and systemic infections. In recent years, emerging resistant

pathogens have forced burn care providers world wide to search

for alternative forms of treatment. Multidrug-resistant

Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter

spp., and various fungal strains have been the major contributors

to the increase in morbidity and mortality rates. Multi-drug-resistant

S. aureus remains the major cause of gram-positive burn wound

infections world wide. Treatment strategies include rigorous

isolation protocols and new types of antibiotics where necessary.

Methods:

We reviewed 398 severely burned patients (burns >40% total

body surface area [TBSA]) admitted to our hospital between

2000 and 2006. Patients who did not contract multi-drug-resistant

gram-negative organisms during their hospital course and received

our standard antibiotic regimen-vancomycin and

piperacillin/tazobactam-served as controls (piperacillin/tazobactam;

n = 280). The treatment group consisted of patients who, during

their acute hospital stay, developed infections with multi-drug-resistant

gram-negative pathogens and were treated with vancomycin and

colistin for at least three days (colistin; n = 118).

Results:

Gram-negative organisms continue to cause the most severe

infections in burn patients. Colistin has re-emerged as a highly

effective antibiotic against multiresistant Pseudomonas and

Acinetobacter infections of burns.

Patients who required colistin therapy had a significantly

larger average total and full-thickness burn than patients

treated with piperacillin/tazobactam and vancomycin, and the

mortality rate was significantly higher in the colistin group

(p less then 0.05). However, there was no significant difference

between the colistin and piperacillin/tazobactam groups in the

incidence of neurotoxicity, hepatic toxicity, or nephrotoxicity.

The main fungal pathogens in burn patients are Candida spp.,

Aspergillus spp., and Fusarium spp. A definitive diagnosis is

more difficult to obtain than in bacterial infections. Amphotericin B

and voriconazole remain the two most important anti-fungal

substances in our practice.

Conclusions:

Innovations in fluid management, ventilatory support, surgical

care, and antimicrobial therapy have contributed to a significant

reduction in morbidity and mortality rates in burn patients.

Vancomycin and clindamycin are the two most important

reserve antibiotics for methicillin-resistant Staphylococcus

aureus infection.

Oxazolidinones and streptogramins have showed high effectiveness

against gram-positive infections. Colistin has re-emerged as a

highly effective antibiotic against multiresistant Pseudomonas

and Acinetobacter infections.

Current challenges include Candida, Aspergillus, and molds. The

development of new agents, prudent and appropriate use of

antibiotics, and better infection control protocols are paramount

in the ongoing battle against multi-resistant organisms.

MaryAnnLiebert

Hidradenitis suppurativa

2009-09-29T03:48:00.000-07:00

Hidradenitis suppurativa

Tidsskr Nor Laegeforen. 2009 May

Tolaas E, Knudsen CW, Sviland L, Tønseth KA.

Hudavdelingen, Haukeland universitetssykehus, 5021 Bergen. etolaas@broadpark.no

BACKGROUND: Hidradenitis suppurativa is a chronic inflammatory skin disease characterized by recurrent tender nodules and boils, usually in the armpits and groins. Draining fistulas and hypertrophic scarring are hallmarks of more severe disease. The objective of this article is to review the clinical presentation, diagnostic considerations and treatment of the disease.

MATERIAL AND METHODS: The article is based on a non-systematic literature search in PubMed, review of dermatology textbooks and the author's personal clinical experience.

RESULTS: Hidradenitis suppurativa, also known as acne inversa, is a follicular occlusion disease that can severely reduce quality of life. Staphylococci and other pathogenic bacteria frequently colonize the lesions, but the disease is not primarily a bacterial infection. Smoking and obesity can worsen disease activity. Moderate and severe disease is usually treated with excisional surgery. Antibiotics, often tetracyclines, are indicated for mild disease and as an adjunct to surgery in more severe disease. Antibiotics, however, are not curative. New treatment options, such as TNF-alpha inhibitors and zinc gluconate should still be considered experimental.

INTERPRETATION: Hidradenitis suppurativa is probably underdiagnosed. The disease is often recalcitrant to treatment. The effect of medical treatment is not supported by high quality evidence.

PubMed

Routine packing of simple cutaneous abscesses is painful and probably unnecessary.

2009-09-29T03:43:00.000-07:00

Routine packing of simple cutaneous abscesses is painful and probably unnecessary.

Acad Emerg Med. 2009 May

O'Malley GF, Dominici P, Giraldo P, Aguilera E, Verma M, Lares C, Burger P, Williams E.

Department of Emergency Medicine, Albert Einstein Medical Center, Philadelphia, PA, USA. omalleyg@einstein.edu

OBJECTIVES: The objective was to determine whether the routine packing of simple cutaneous abscesses after incision and drainage (I&D) confers any benefit over I&D alone.

METHODS: In a prospective, randomized, single-blinded trial, subjects with simple cutaneous abscesses (less than 5 cm largest diameter) underwent incision, drainage, irrigation, and standard abscess preparation in the usual manner. Subjects were then randomized to either packing or no-packing. Visual analog scales (VAS; 100 mm) of pain were recorded in the emergency department (ED). All patients received trimethoprim-sulfamethoxazole (TMP-SMX), ibuprofen, and narcotic prescriptions, recorded twice daily VAS pain scores, and returned in 48 hours at which time dressings and packing, if present, were removed and a physician blinded to the randomization and not part of the initial visit repeated measurements and determined the need for further intervention.

RESULTS: Forty-eight subjects were included in the final analysis. There were no significant differences in age, sex, abscess location, or initial pain scores between the two groups. There was no significant difference in need for a second intervention at the 48-hour follow-up between the packed (4 of 23 subjects) and nonpacked (5 of 25 subjects) groups (p = 0.72; relative risk = 1.3, 95% confidence interval [CI] = 0.4 to 4.2). Patients in the group that received packing reported higher pain scores immediately postprocedure (mean difference = 23.8 mm; p = 0.014, 95% CI = 5 to 42 mm) and at 48 hours postprocedure (mean difference = 16.4 mm; p = 0.03, 95% CI = 1.6 to 31.2 mm), as well as greater use of ibuprofen (mean difference = 0.32; p = 0.12, 95% CI = -1.4 to 2.0) and oxycodone/acetaminophen (mean difference = 2.19; p = 0.03, 95% CI = 0.2 to 4.1).

CONCLUSION: In this pilot study, not packing simple cutaneous abscesses did not result in any increased morbidity, and patients reported less pain and used fewer pain medications than packed patients.

Wiley InterScience

Staphylococcal scalded skin syndrome in an adult patient with T-lymphoblastic non-Hodgkin's lymphoma.

2009-09-29T03:39:00.000-07:00

Staphylococcal scalded skin syndrome in an adult patient with T-lymphoblastic non-Hodgkin's lymphoma.

Onkologie. 2008 Nov

Scheinpflug K, Schalk E, Mohren M.

Klinik fur Hamatologie/Onkologie, Universitatsklinikum Magdeburg, Magdeburg, Germany. katrin.scheinpflug@med.ovgu.de

BACKGROUND: Staphylococcal scalded skin syndrome (SSSS) is an exfoliative dermatitis caused by Staphylococcus aureus infection. In contrast to infants, it is rarely observed in adults. SSSS in adults usually occurs in predisposed individuals such as those with renal failure or immunodeficiency, but has also been reported in otherwise healthy subjects. The reported mortality rate in adults is usually high because of serious underlying disease.

PATIENT AND METHODS: We report a case of SSSS in a young female patient with T-lymphoblastic lymphoma, who survived this potentially lethal complication.

CONCLUSIONS: To the best of our knowledge, this is the first case of SSSS in an adult patient with T-lymphoblastic non-Hodgkin's lymphoma. Clinicians should be aware of SSSS as a rare but potentially fatal disorder, particularly in adult patients with malignancies undergoing aggressive chemotherapy.

Karger/Onkologie

Cat scratch disease: a diagnostic conundrum

2009-09-29T03:34:00.000-07:00

Cat scratch disease: a diagnostic conundrum

C Scott MRCP^*, A Azwa MRCP^*, C Cohen MRCP^*, M McIntyre FRCP andN Desmond FRCP

^* Department of Sexual Health & HIV Medicine, St Stephens Centre, Chelsea & Westminster Hospital, 369 Fulham Road, London SW10 9NH; Department of Microbiology, Wexham Park Hospital, Slough; The Garden Clinic, Upton Hospital, Slough, UK

Correspondence to: Dr C Scott Email: christopher.scott@chelwest.nhs.uk

Key Words: cat scratch disease • Bartonella henselae • Lymphogranuloma venereum • inguinal lymphadenopathy

We report the case of a patient who presented to a clinic forevaluation of inguinal lymphadenopathy. Histology of the lymphnodes revealed micoabscess formation suggesting infection withLymphogranuloma venereum (LGV) or Bartonella henselae –the causative agent in cat scratch disease (CSD). The patientrecalled no preceding animal exposure. Clinical and serologicalfindings initially suggested early LGV but convalescent serologysupported CSD. This serves as an important reminder that B.henselae infection should be considered a cause of regionallymphadenopathy in individuals suspected of having LGV.

International Journal of STD & AIDS

Guidelines Issued for Management of Opportunistic Infections Among HIV-Exposed Children

2009-09-24T03:03:00.000-07:00

Guidelines Issued for Management of Opportunistic Infections Among HIV-Exposed Children

News Author: Laurie Barclay, MDCME Author: Charles P. Vega, MD, FAAFP

September 8, 2009 — Children who either have been exposed to HIV or who are infected with HIV are at increased risk for certain opportunistic diseases, according to new recommendations published online August 26 in the Morbidity and Mortality Weekly Report.

The new guidelines were issued jointly by the US Centers for Disease Control and Prevention, the National Institutes of Health (NIH), the HIV Medicine Association of the Infectious Diseases Society of America, the Pediatric Infectious Diseases Society, and the American Academy of Pediatrics.

These guidelines update previous recommendations for clinicians and other healthcare practitioners providing medical care for HIV-exposed or HIV-infected children. Earlier guidelines were last published in 2002 and 2004, respectively.

"In the pre-antiretroviral era and before development of potent combination highly active antiretroviral treatment (HAART) regimens, opportunistic infections (OIs) were the primary cause of death in [HIV]-infected children," write Lynne M. Mofenson, MD, from the NIH in Bethesda, Maryland, and colleagues.

"Current HAART regimens suppress viral replication, provide significant immune reconstitution, and have resulted in a substantial and dramatic decrease in [AIDS]-related OIs and deaths in both adults and children.... Despite this progress, prevention and management of OIs remain critical components of care for HIV-infected children."

Development of Updated Guidelines

The Pediatric Opportunistic Infections Working Group, a panel of experts from the US government and academic institutions specializing in pediatric HIV infection and other infectious diseases, developed recommendations for the most effective strategies for diagnosis, prevention, and treatment of OIs.

For each OI, a pediatric specialist expert in that OI reviewed the literature for new information published since the previous guidelines were issued. In June 2007, revised recommendations were proposed at an NIH meeting, and the draft guidelines were revised further, reviewed and approved by the working group, and approved by the issuing organizations.

In addition to covering the management of opportunistic diseases encountered in the United States (Pneumocystis pneumonia, Toxoplasma gondii, Mycobacterium avium complex, Coccidioides species, Cryptococcus neoformans, Histoplasma capsulatum, microsporidiosis, cytomegalovirus, invasive bacterial infections, bartonellosis, Candida [esophageal], and herpes simplex virus), the guidelines also discuss malaria — an OI that could be acquired during international travel.

For each OI, the report summarizes epidemiology, clinical presentation, and diagnosis in children. Main topics include preventing exposure to OIs, using chemoprophylaxis and/or vaccination to prevent infection, discontinuing primary prophylaxis after immune reconstitution, treating OIs, monitoring for adverse effects during treatment, managing treatment failure, preventing recurrence of OIs, and discontinuing secondary prophylaxis after immune reconstitution.

A working group of experts specializing in adult HIV and infectious disease prepared a separate report on the prevention and treatment of OIs in HIV-infected adults and postpubertal adolescents, titled "Guidelines for the Prevention and Treatment of Opportunistic Infections in HIV-Infected Adults and Adolescents."

Populations Affected by OIs

Because HIV-infected women coinfected with opportunistic pathogens may be more likely than women uninfected with HIV to transmit these OIs to their infants, an infected mother is an important pathway for OI transmission, as well as for HIV infection, among children. Furthermore, mothers and other family members coinfected with HIV and certain opportunistic pathogens may be more likely to transmit these infections horizontally to young children, increasing the probability that the child will primarily acquire these infections.

OIs may therefore affect not just HIV-infected infants but also HIV-exposed but uninfected infants who become infected by the pathogen via HIV-infected mothers or family members with coinfections. For these reasons, the updated guidelines for treating OIs in children consider treatment of infections among all children — both HIV-infected and uninfected — born to HIV-infected women.

Incidence of HIV infection is rising both among adolescents with perinatal infection who have survived into their teenage years and among youth with behaviorally acquired HIV infection. The adult OI guidelines are applicable to postpubertal adolescents, but younger prepubertal or pubertal adolescents may have differing drug pharmacokinetics and response to treatment, with management best served by the pediatric guidelines.

Updated Recommendations

Since the previous versions of these guidelines, major changes in the new recommendations are as follows:

Increased emphasis on the importance of antiretroviral therapy to prevent and treat OIs, particularly those OIs for which no specific treatment is available.

New evidence regarding diagnosis and management of immune reconstitution inflammatory syndromes.

New information concerning management of antiretroviral therapy in children with OIs, including potential drug–drug interactions.

New strategies for diagnosis of HIV infection and for presumptively ruling out HIV infection in infants that affect the need to start prophylaxis for the prevention of Pneumocystis jirovecii pneumonia in neonates. Prophylaxis against Pneumocystis carinii should be considered in all infants exposed to HIV.

Updated recommendations for immunizing HIV-exposed and HIV-infected children against hepatitis A, human papillomavirus, meningococcus, and rotavirus. Children with HIV infection and good immune function should be routinely vaccinated against varicella, measles-mumps-rubella, and human papillomavirus. To weigh potential risks and benefits of vaccination against rotavirus in an infant exposed to HIV infection, expert consultation may be needed.

New sections on aspergillosis; bartonella; human herpes viruses 6, 7, and 8; malaria; and progressive multifocal leukodystrophy. Children infected with HIV do not require routine prophylaxis against aspergillosis, coccidiomycosis, or cryptococcal disease.

New guidelines for discontinuing OI prophylaxis after immune reconstitution in children.

In addition, there are 6 tables with information concerning prevention and treatment of OIs in children and 2 figures depicting immunization recommendations for children aged 0 to 6 years and 7 to 18 years. The guidelines authors acknowledge that treatment of OIs is an evolving science and that therapeutic options and preferences may change on the basis of the availability of new agents or clinical data on existing agents. The recommendations in these guidelines will therefore be updated periodically and posted on the NIH AIDSinfo Web site.

Morb Mortal Wkly Rep. Published online August 26, 2009.

Clinical Context

The main cause of HIV infection among children is vertical transmission from their mother, and the current guidelines highlight that the mother and nuclear family unit continue to be a strong potential reservoir for OIs as these children grow. These OIs may also infect infants without HIV infection. Therefore, the authors of the current guidelines focus their recommendations regarding OI prevention and treatment to all children born to women with HIV infection.

The guidelines regarding OIs among children were last updated in 2004. The current revised recommendations were initially proposed by an expert panel at a meeting of the NIH in 2007 and were then endorsed by multiple governmental and physician specialty groups.

Study Highlights

The use of HAART among children can be useful to both prevent and treat OIs for which specific treatments are less effective, including infections such as cryptosporidiosis and microsporidiosis.

Immune reconstitution inflammatory syndrome (IRIS) can occur in children after the initiation of treatment of HIV infection. However, among adults, up to 30% of cases of IRIS may be present at 3 months after initiation of HAART. HAART should be continued in cases of IRIS, and nonsteroidal anti-inflammatory drugs should be added, along with close supervision, for adequate treatment of most moderate cases. Antibiotics are unnecessary in the treatment of IRIS.

The best timing to initiate HAART after an OI remains unclear and needs to be individualized to the patient's needs.

Vaccination against varicella and measles-mumps-rubella may be considered among HIV-infected children with age-specific CD4 levels of at least 15%.

Although vaccine immune response may be less than among immunocompetent peers, the human papillomavirus vaccine may be administered to girls with HIV infection.

There are no safety data regarding the application of the rotavirus vaccine to infants who are potentially immunocompromised, and the diagnosis of HIV infection in the infant may not even be established at the time of the first vaccination. Whether to provide vaccination against rotavirus among infants exposed to HIV may require consultation with an expert in infectious disease or immunology.

Bartenellosis may be prevented by the avoidance of body lice, cats, and cat fleas. Moderate cat-scratch disease among children with HIV infection typically does not respond to antibiotic therapy, and treatment is supportive.

Previous estimates have found that 1.1% of children with tuberculosis have a coinfection with HIV, a lower rate vs the adult population. Children with HIV infection should receive annual tuberculin skin tests. Treatment of active tuberculosis is similar among children with and without HIV, although the concurrent use of HAART can complicate tuberculosis treatment (particularly the use of rifamycins). The usual treatment period is 6 months.

Clarithromycin and azithromycin may be used to prevent M avium complex disease in children, but children with a sustained positive immune response to HAART for 3 months or longer may discontinue antibiotic prophylaxis against M avium complex.

Prophylaxis against aspergillosis and coccidiomycosis among children with HIV infection is not recommended. Voriconazole is the first-line therapy for active aspergillosis, and disseminated coccidiomycosis infection requires treatment with amphotericin B.

Children with HIV infection do not require routine testing for the cryptococcal antigen or prophylaxis against infection with cryptococcus.

Conversely, infants born to mothers with HIV infection should be considered for antibiotic prophylaxis against P carinii beginning at ages 4 to 6 weeks. Trimethoprim-sulfamethoxazole is the first-line agent for prophylaxis.

Children with HIV infection traveling to endemic areas of malaria infection should receive prophylactic antibiotics against malaria, and care must be taken to avoid significant interactions with HAART, if possible. Trimethoprim-sulfamethoxazole should not be used as prophylaxis against malaria.

Clinical Implications

The current study recommends routine vaccination against varicella, measles-mumps-rubella, and human papillomavirus among children with HIV infection and good immune function. However, vaccination against rotavirus may require consultation with an expert to weigh potential risks and benefits in an infant exposed to HIV infection.

Children with HIV infection do not require routine prophylaxis against aspergillosis, coccidiomycosis, or cryptococcus, but all infants exposed to HIV should be considered for prophylaxis against P carinii.

Medscape

Complications of Infective Endocarditis.

2009-09-20T12:30:00.000-07:00

Complications of Infective Endocarditis.
Cardiovasc Hematol Disord Drug Targets. 2009 Sep

Mocchegiani R, Nataloni M.
Via Tommasi 5, 60124 Ancona, Italy. r_mocc@yahoo.it.

Infective endocarditis (IE) is a lethal disease if not promptly treated with antibiotics, either in association with surgery or not. The incidence of disease has not decreased over the last decades due to the change of risk conditions. Complications of IE may involve cardiac structures when the infection spreads within the heart, or extra cardiac ones when the cause is usually from embolic origin; they may also be due to medical treatment or to the septic condition itself. A variety of complications may occur in most of patients. The literature reports one complication of IE in 57%, two in 26% and three or more in about 14% of patients examined. The frequency of specific complications depends on variables as the infecting pathogen, duration of disease before therapy and type of treatment. However it is often difficult to assess the true incidence of complications because the published reviews in literature are frequently based on retrospective chart reviews and different diagnostic criteria are used. The decision over either indication or timing of surgery should be individualized and based on a multidisciplinary approach involving at least cardiologists and cardiac surgeons. Congestive heart failure (CHF) is the most important complication of IE, which has the greatest impact on prognosis. Periannular abscesses are a relatively common complication of IE (42% to 85% of cases during surgery or at autopsy respectively), associated with a higher morbidity and mortality. Systemic embolization occurs in 22% to 50% of cases; emboli may involve major arteries, mostly affecting the central nervous system, but also other organs. Splenic abscess is a rare complication of IE, due to direct seeding of spleen by an embolus or bacterial seeding of a bland infarction. Neurological complications develop in 20% to 40% of patients with IE and represent a dangerous subset of complications. Mycotic aneurysms are rare, resulting from diffusion of infection to the vessel wall. Actually the clinical profile, the best treatment (medical or surgical approach) and outcome of complicated IE are not well defined. Changing trends in aetiology of IE with emerging infections from Staphylococci, bacteria of the HACEK group and Fungi have resulted in an increased frequency of culture negative IE. Sepsis or persistent fever despite appropriate antimicrobial therapy, recurrent emboli, heart failure or new pathologic murmurs suggest haemodynamic impairment and/or infection extending beyond the valve leaflet or prosthetic valvular annulus. The course of the disease will consequently get worse with an increasing need of surgery. Patients who develop abscesses are more likely to undergo surgery than those who do not (84-91% vs 36%), and also their in-hospital mortality rate is higher (19% vs 11%). A prompt detection of complications often allows an earlier surgical treatment which represents the best way to improve the outcome. The introduction of molecular methods techniques has increased the ability to identify the causal agents of IE, mostly in cases of culture negative endocarditis. Echocardiography, mainly from transesophageal (TEE) approach, has significantly improved the evaluation of IE allowing to detect the specific signs of the disease as vegetations, abscesses, valve insufficiency, prosthetic valve dehiscence, fistulas. In our 3rd referral Hospital (Lancisi Heart Hospital, Ancona, Italy) we performed a follow-up (mean 8.26 years) of 15 patients with periannular complications associated with IE. The long term follow-up showed low mortality rate, high incidence of reintervention, improved New York Heart Association (NYHA) class in survivors and no changes of the lesions at the echocardiographic examination, suggesting that periannular complications have not significantly influenced the overall survival in our patients at the follow-up.

PMID: 19751182 [PubMed - as supplied by publisher]

Corruption of Innate Immunity by Bacterial Proteases.

2009-09-17T06:45:00.000-07:00

Corruption of Innate Immunity by Bacterial Proteases.

J Innate Immun. 2009 Jan

Potempa J, Pike RN.
Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Krakow, Poland, and Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA, USA.

The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

PubMed

Diagnosis and management of acute rhinosinusitis.

2009-06-11T08:18:00.000-07:00

Diagnosis and management of acute rhinosinusitis.
Postgrad Med. 2009 May
Desrosiers M.
Hotel-Dieu de Montreal Hospital, 3840 St-Urbain Street, Montreal, Quebec, Canada. desrosiers_martin@hotmail.com

Acute rhinosinusitis (ARS) is a highly prevalent condition with substantial public health implications. The disease is associated with a high degree of disability, impairment of quality of life, and school and workplace absenteeism. Acute rhinosinusitis is most often precipitated by a viral upper respiratory infection or an episode of allergic rhinitis. Typical signs and symptoms include nasal congestion, purulent nasal discharge, headache, cough, and facial pain or tenderness. Diagnosis is usually based on patient history and physical examination. Specialist consultation is indicated for intractable or complicated disease, signified by signs or symptoms suggestive of orbital, intraosseous, or intracranial extension of sinus disease. Most cases of ARS in the ambulatory setting are viral. In the absence of severe or rapidly worsening symptoms, antibiotic prescription should be delayed until an appropriate surveillance period has elapsed. Symptomatic therapy is the most efficient approach for uncomplicated ARS. There is a paucity of data supporting use of commonly used symptomatic therapies, with the exception of intranasal corticosteroids, which have demonstrated rapid improvement of the symptoms of ARS and return to normal functioning when used as monotherapy or as an adjunct to antibiotics.

PubMed

Bacterial Meningitis in HIV-1-Infected Patients in the Era of Highly Active Antiretroviral Therapy.

2009-06-11T07:51:00.000-07:00

Bacterial Meningitis in HIV-1-Infected Patients in the Era of Highly Active Antiretroviral Therapy.

J Acquir Immune Defic Syndr. 2009 Jun

Domingo P, Suarez-Lozano I, Torres F, Pomar V, Ribera E, Galindo MJ, Cosin J, Garcia-Alcalde ML, Vidal F, Lopez-Aldeguer J, Roca B, Gonzalez J, Lozano F, Garrido M; on behalf of the VACH Cohort Study Group.
From the *Hospital de la Santa Creu i Sant Pau, Barcelona, Spain; daggerHospital Infanta Elena, Huelva, Spain; double daggerLaboratori de Bioestadística i Epidemiologia (Universitat Autònoma de Barcelona), IDIBAPS (Hospital Clínic), Barcelona, Spain; section signHospital Vall d'Hebrón, Barcelona, Spain; parallelHospital Clinico, Valencia, Spain; paragraph signHospital Gregorio Marañón, Madrid, Spain; #Hospital de Cabueñes, Gijón, Spain; **Hospital Universitari de Tarragona Joan XXIII, IISPV, Universitat Rovira i Virgili, Tarragona; daggerdaggerHospital La Fe, Valencia, Spain; double daggerdouble daggerHospital General, Castellón, Spain; section sign section signHospital La Paz, Madrid, Spain; parallel parallelHospital de Valme, Sevilla, Spain; and paragraph sign paragraph signVACH Data Management Group, Huelva, Spain.

BACKGROUND:

The burden that spontaneous bacterial meningitis (SBM) currently represents among HIV-1-infected patients is poorly known.

METHODS:

We prospectively evaluated 32 episodes of SBM in HIV-1-infected patients from the VACH (VIH-Aplicación de Control Hospitalario) Cohort and compared findings with those of 267 episodes in uninfected persons, matched by age and year of infection. A group of 13,187 HIV-1-infected patients from the VACH Cohort were used to identify predictors for acquiring SBM.

RESULTS:

Between 1997 and 2006, we found 32 episodes of SBM among HIV-1-infected patients for an annual incidence rate of 62.0 cases per 100,000 population compared with 3.2 (3.0 to 3.4) per 100,000 population for uninfected patients (P <>/=200/mm count was the only predictor for developing SBM. Compared with uninfected, HIV-1-infected patients with SBM had a greater prevalence of primary extrameningeal infection, especially pneumonia (P = 0.02), bacteremia (P = 0.02), focal neurologic signs (P = 0.005), seizures (P = 0.06), a lower cerebrospinal fluid to blood glucose ratio (P = 0.02), and a lower prevalence of nuchal rigidity (P = 0.005). Streptococcus pneumoniae was the most frequent etiologic agent among HIV-1-infected patients. HIV-1-infected patients had neurologic complications more frequently (P = 0.02), a higher overall case fatality rate (P = 0.004), and greater incidence of neurologic sequelae (P = 0.001). '

CONCLUSIONS:

Even in the highly active antiretroviral therapy era, the risk of developing SBM is 19 times higher among HIV-1-infected patients than among uninfected ones. It tends to present in severely immunosuppressed patients not previously vaccinated and off antiretroviral therapy, with a concomitant extrameningeal infection, bacteremia, and focal neurologic signs, and is caused by S. pneumoniae. SBM in HIV-1-infected patients carries a worse prognosis than in uninfected ones both in terms of lethality and sequelae.

PMID: 19512939 [PubMed - as supplied by publisher]

Bacterial vaginosis

2009-05-19T06:50:00.000-07:00

Bacterial vaginosis

Med Clin (Barc). 2009 May 15

Jesús De La Calle I, Jesús De La Calle MA.
Servicio de Microbiología, Hospital Universitario Puerto Real, Cádiz, España.

Bacterial vaginosis is a widely spread health problem with multiple connotations. It has been the subject of many studies and work during decades and it still remains a polemic entity, with contradictory finding. The polymicrobian etiology, unsolved epidemiology, obstetrico-gynecological complications and high recurrence rate following treatment, make this infection a target for researchers. It is not an inflammatory process -yet an immune response exists. In this disorder, vaginal discharge increases, and it is associated with a high risk of developing sexually transmitted diseases.

PMID: 19447450 [PubMed - as supplied by publisher]

Hidradenitis suppurativa

2009-05-19T06:46:00.000-07:00

Hidradenitis suppurativa
Tidsskr Nor Laegeforen. 2009 May

Tolaas E, Knudsen CW, Sviland L, Tønseth KA.
etolaas@broadpark.no

Hudavdelingen Haukeland universitetssykehus 5021 Bergen * Nåvaerende adresse: Hudlegene på Nesttun Nesttunveien 109 5221 Nesttun.

BACKGROUND: Hidradenitis suppurativa is a chronic inflammatory skin disease characterized by recurrent tender nodules and boils, usually in the armpits and groins. Draining fistulas and hypertrophic scarring are hallmarks of more severe disease. The objective of this article is to review the clinical presentation, diagnostic considerations and treatment of the disease.

MATERIAL AND METHODS:. The article is based on a non-systematic literature search in PubMed, review of dermatology textbooks and the author's personal clinical experience.

RESULTS: Hidradenitis suppurativa, also known as acne inversa, is a follicular occlusion disease that can severely reduce quality of life. Staphylococci and other pathogenic bacteria frequently colonize the lesions, but the disease is not primarily a bacterial infection. Smoking and obesity can worsen disease activity. Moderate and severe disease is usually treated with excisional surgery. Antibiotics, often tetracyclines, are indicated for mild disease and as an adjunct to surgery in more severe disease. Antibiotics, however, are not curative. New treatment options, such as TNF-α inhibitors and zinc gluconate should still be considered experimental.

INTERPRETATION: Hidradenitis suppurativa is probably underdiagnosed. The disease is often recalcitrant to treatment. The effect of medical treatment is not supported by high quality evidence.

PMID: 19448752 [PubMed - as supplied by publisher]

Review of the guidelines for complicated skin and soft tissue infections and intra-abdominal infections--are they applicable today?

2008-12-30T08:19:00.000-08:00

Review of the guidelines for complicated skin and soft tissue infections and intra-abdominal infections--are they applicable today?

Clin Microbiol Infect. 2008 Dec
Caínzos M.

Hospital Clínico Universitario, Medical School, Santiago de Compostela, Spain. ci28@usc.es

Difficult-to-treat infections in surgical patients, such as serious skin and soft tissue infections (SSTIs) and complicated intra-abdominal infections (cIAIs), are the cause of significant morbidity and mortality, and carry an economic burden. These surgical site infections are typically polymicrobial infections caused by a plethora of pathogens, which include difficult-to-treat organisms and multiresistant Gram-positive and Gram-negative strains. Optimal management of SSTIs and cIAIs must take into account the presence of resistant pathogens, and depends on the administration of appropriate antimicrobial therapy (i.e. the correct spectrum, route and dose in a timely fashion for a sufficient duration as well as the timely implementation of source control measures). Treatment recommendations from the Infectious Diseases Society of America and the Surgical Infection Society are available for guidance in the management of both of these infections, yet the increased global prevalence of multidrug-resistant pathogens has complicated the antibiotic selection process. Several pathogens of concern include methicillin-resistant Staphylococcus aureus, responsible for problematic postoperative infections, especially in patients with SSTIs, extended-spectrum beta-lactamase-producing Gram-negative bacteria, including CTX-M-type-producing Escherichia coli strains, and multidrug-resistant strains of Bacteroides fragilis. New empirical regimens, taking advantage of potent broad-spectrum antibiotic options, may be needed for the treatment of certain high-risk patients with surgical site infections.

PubMed

Modern Concepts of the Diagnosis and Treatment of Necrotizing Fasciitis

2008-12-30T08:14:00.000-08:00

Modern Concepts of the Diagnosis and Treatment of Necrotizing Fasciitis
J Emerg Med. 2008 Dec 10.

Edlich RF, Cross CL, Dahlstrom JJ, Long WB 3rd.
Director of Trauma Prevention, Education and Research, Legacy Verified Level I Shock Trauma Center at Legacy Emanuel Hospital, Portland, Oregon.

Background: Necrotizing fasciitis is a potentially fatal infection involving rapidly progressive, widespread necrosis of the superficial fascia. Objectives: The purpose of this collective review is to review modern concepts of the treatment and diagnosis of necrotizing fasciitis.

Discussion: Necrotizing fasciitis is characterized by widespread necrosis of the subcutaneous tissue and the fascia. Although the pathogenesis of necrotizing fasciitis is still open to speculation, the rapid and destructive clinical course of necrotizing fasciitis is thought to be due to multibacterial symbiosis.

During the last two decades, scientists have found that the pathogenesis of necrotizing fasciitis is usually polymicrobial, rather than monomicrobial. Although there has been no published well-controlled, clinical trial comparing the efficacies of various diagnostic imaging modalities in the diagnosis of necrotizing infections, magnetic resonance imaging (MRI) is the preferred technique to detect soft tissue infection. MRI provides unsurpassed soft tissue contrast and spatial resolution, has high sensitivity in detecting soft tissue fluid, and has multiplanar capabilities.

Percutaneous needle aspiration followed by prompt Gram's staining and culture for a rapid bacteriologic diagnosis in soft tissue infections is recommended. Surgery complemented by antibiotics is the primary treatment of necrotizing fasciitis.

Conclusion: Wide, extensive debridement of all tissues that can be easily elevated off the fascia with gentle pressure should be undertaken. Successful use of intravenous immunoglobulin has been reported in the treatment of streptococcal toxic shock syndrome. The use of adjunctive therapies, such as hyperbaric oxygen therapy, for necrotizing fasciitis infection continues to receive much attention.

Elsevier/ScienceDirect

Bacterial contamination of surgeons gloves during shunt insertion: a pilot study

2008-11-22T04:13:00.000-08:00

Bacterial contamination of surgeons gloves during shunt insertion: a pilot study

Br J Neurosurg. 2008 Oct

Sørensen P, Ejlertsen T, Aaen D, Poulsen K.
Department of Neurosurgery and Department of Clinical Microbiology, University Hospital of Aalborg, Denmark.

Bacterial infection is a major cause of shunt dysfunction. It is well-known that the majority of pathogenic micro-organisms are low-virulent bacteria normally found on intact skin. Probably shunts become contaminated during surgery either by contact to the patient skin, or contact from contaminated gloves or instruments. This study was performed to find out to what extent gloves become contaminated during shunt surgery. Gloves used during shunt implantation were examined in 10 operations. Shunt implantation was done using recommended precautions to avoid infection, including prophylactic antibiotics and double gloving, by surgeons experienced in shunt surgery. Surgical incision, dissection and tunnelling were done. Then the surgeon, the scrub-nurse and, in three cases, the assistant made an imprint of their outer gloves on agar plates. Hereafter, they changed the outer pair of gloves before handling the shunt and completing the operation. The plates were cultured for 6 days in both aerobic and anaerobic environment. In all cases the surgeons gloves were contaminated, and in six cases also the nurses' gloves were contaminated, as well as all three assistants. Propionebacterium acnes were cultured from gloves in all 10 operations and coagulase-negative Staphylococci were found in eight operations. These results are preliminary, but nevertheless they are alarming. Despite the use of recommended precautions to avoid infections we found that a substantial numbers of gloves from surgeon, scrub nurse and assistant were contaminated with micro-organisms less than 15 min after surgery has been commenced and before the shunts were handled. This study offers a feasible, simple and logical explanation of how shunts may become contaminated and infected. A simple measure would be to change the outer pairs of gloves before handling of the shunt material during surgery, as was done in this study, where non-shunt infections were observed.

Informaworld

Surgical site infections: epidemiology, microbiology and prevention.

2008-11-22T04:09:00.000-08:00

Surgical site infections: epidemiology, microbiology and prevention.
J Hosp Infect. 2008 Nov

Owens CD, Stoessel K.
Kimberly-Clark Healthcare, Atlanta, GA, USA.

Surgical site infections (SSIs) are defined as infections occurring up to 30 days after surgery (or up to one year after surgery in patients receiving implants) and affecting either the incision or deep tissue at the operation site. Despite improvements in prevention, SSIs remain a significant clinical problem as they are associated with substantial mortality and morbidity and impose severe demands on healthcare resources. The incidence of SSIs may be as high as 20%, depending on the surgical procedure, the surveillance criteria used, and the quality of data collection. In many SSIs, the responsible pathogens originate from the patient's endogenous flora. The causative pathogens depend on the type of surgery; the most commonly isolated organisms are Staphylococcus aureus, coagulase-negative staphylococci, Enterococcus spp. and Escherichia coli. Numerous patient-related and procedure-related factors influence the risk of SSI, and hence prevention requires a 'bundle' approach, with systematic attention to multiple risk factors, in order to reduce the risk of bacterial contamination and improve the patient's defences. The Centers for Disease Control and Prevention guidelines for the prevention of SSIs emphasise the importance of good patient preparation, aseptic practice, and attention to surgical technique; antimicrobial prophylaxis is also indicated in specific circumstances. Emerging technologies, such as microbial sealants, offer the ability to seal and immobilise skin flora for the duration of a surgical procedure; a strong case therefore exists for evaluating such technologies and implementing them into routine clinical practice as appropriate.

PMID: 19022115 [PubMed - as supplied by publisher]

Security swipe cards and scanners are a potential reservoir for hospital-acquired infection.

2008-11-12T06:01:00.000-08:00

Security swipe cards and scanners are a potential reservoir for hospital-acquired infection.
Ann R Coll Surg Engl. 2008 Nov 4

Sultan M, Alm A, Hindmarsh A, Greatorex R.

INTRODUCTION Hospital-acquired infections complicate 10% of hospital admissions resulting in increased morbidity, mortality and cost to hospitals. Most hospitals issue doctors with plastic swipe cards that function as electronic keys to access clinical areas. The card is handled many times a day, often before direct patient contact. The aim of this study was to determine if swipe cards harbour potentially harmful bacteria.

SUBJECTS AND METHODS On a single day, doctors working in the surgical directorate completed a questionnaire to determine their pattern of swipe card use. Cards were inoculated onto agar plates and incubated for 48 h under standard laboratory conditions, following which the number of colony forming units (CFUs) cultured from each card was determined. Representative colonies were sampled and sub-cultured for staphlococcal, enterococcal, coliform and pseudomonad species. Isolated bacterial pathogens were tested for antimicrobial sensitivity. Swipe-card scanners were swabbed for microbiological culture on the same day.

RESULTS All cards were colonised with environmental bacteria (mean, 73 CFU). Of cards, 21% were contaminated with pathogenic bacteria including Staphylococcusaureus (5.1%), Pseudomonasputida (2.6%), and coliformspecies (12.8%). The pattern of card use did not significantly affect the amount of bacterial contamination, but infrequent use of the card and keeping the card in a pocket or wallet was associated with higher levels of contamination. Environmental bacteria were cultured from 88% of card scanners, the highest counts coming from scanners in main theatres and the day-surgery unit.

CONCLUSIONS Doctors' swipe cards are contaminated with, and may therefore be a reservoir for, pathogenic bacteria implicated in hospital-acquired infection.

IngentaConnect

Rapid detection and quantification of Propionibacteriaceae

2008-11-04T05:10:00.000-08:00

Rapid detection and quantification of Propionibacteriaceae
Br J Ophthalmol. 2008 Oct 31

Goldschmidt P, Mora Ferreria C, Degorge S, Benallaoua D, Boutboul S, Laroche L, Batellier L, Chaumeil C.
France.

Introduction: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Today's methods of diagnosis for Propioni are unsatisfactory due to lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties for interpretation of SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). Material and methods: DNA was extracted using the MagNA Pure(R) isolation kit (Roche) and bacterial detection and quantification was carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). PCR cycling program consisted in one cycle at 95 degrees C, 20 sec and 45 cycles at 95 degrees C, 3 sec and 30 sec at 60 degrees C. DNA extraction yields were assessed in the same tube.

RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in PBS, aqueous humor, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humor and human cells in less of 1.30 h.

PMID: 18977791 [PubMed - as supplied by publisher]

Blistering erysipelas: not a rare entity

2008-10-26T07:41:00.000-07:00

Blistering erysipelas: not a rare entity
Singapore Med J. 2008 Oct

Chong FY, Thirumoorthy T.
Dermatology Unit, Singapore General Hospital, Outram Road, Singapore 169608. feiyon@yahoo.com

INTRODUCTION: Soft tissue infections are common, but erysipelas, especially its blistering feature, is an under-recognised entity. There have been few reports of blistering erysipelas. We aim to describe the clinical characteristics, management and the risk factors for erysipelas in 20 patients admitted in a tertiary hospital in Singapore.

METHODS: A chart review of all cases of erysipelas, diagnosed by experienced dermatologists and admitted to the Singapore General Hospital during the period January 2006 to August 2006, was conducted.

RESULTS: There were 20 patients (11 male, nine female) with an average age of 62.2 (range 31-86) years. The most commonly-involved site was the leg (75 percent), followed by the arm (15 percent) and face (ten percent). The clinical characteristics were well dermarcated (50 percent), erythema (100 percent) and oedema (85 percent), and bullae and vesicles formation (80 percent). Most presented with no pain (40 percent) and minimal signs of systemic toxicity. There was no positive blood culture, but the swab on the blistering erysipelas yielded positive cultures in 67 percent. The most common predisposing factor was disruption in the skin barrier (65 percent), followed by venous insufficiency (20 percent) and lymphoedema (25 percent). All patients received empirical antibiotics, most commonly penicillin and cloxacillin (65 percent), for an average duration of 20.65 (10-41) days, and with local care, there was complete resolution.

CONCLUSION: In our experience, erysipelas is a clinically distinct entity and commonly presents with bullae or vesicles. It has favourable prognosis, and rarely develops any complication with timely and appropriate therapy.

PMID: 18946616 [PubMed - in process]

Campylobacter Bacteremia: Clinical Features and Factors Associated with Fatal Outcome

2008-08-15T03:18:00.000-07:00

Campylobacter Bacteremia: Clinical Features and Factors Associated with Fatal Outcome

Clin Infect Dis. 2008 Aug

Pacanowski J, Lalande V, Lacombe K, Boudraa C, Lesprit P, Legrand P, Trystram D, Kassis N, Arlet G, Mainardi JL, Doucet-Populaire F, Girard PM, Meynard JL; CAMPYL Study Group.

1Service des Maladies Infectieuses et Tropicales and 2Laboratoire de Microbiologie, Hôpital Saint-Antoine, 3Laboratoire de Bactériologie, Hôpital La Pitié-Salpétrière, 4Laboratoire de Bactériologie, Hôpital Tenon, 5Service de Microbiologie, Unité Mobile de Microbiologie Clinique, Hôpital Européen Georges Pompidou, 6Université Paris VI Pierre et Marie Curie, 7Université Paris V René Descartes, 8INSERM UMR-S707, and 9Unité EA 4065, Paris, 10Unité Contrôle Epidémiologie et Prévention de l'Infection and 11Laboratoire de Microbiologie, Hôpital Henri Mondor, Créteil, 12Laboratoire de Microbiologie, Hôpital Paul Brousse, Villejuif, and 13Laboratoire de Microbiologie, Hôpital de Versailles, Le Chesnay, France.

Background. Campylobacter bacteremia is uncommon. The influence of underlying conditions and of the impact of antibiotics on infection outcome are not known.

Methods. From January 2000 through December 2004, 183 episodes of Campylobacter bacteremia were identified in 23 hospitals in the Paris, France, area.

The medical records were reviewed. Characteristics of bacteremia due to Campylobacter fetus and to other Campylobacter species were compared. Logistic regression analysis was performed to identify risk factors for fatal outcome within 30 days.

Results. Most affected patients were elderly or immunocompromised. C. fetus was the most commonly identified species (in 53% of patients). The main underlying conditions were liver disease (39%) and cancer (38%). The main clinical manifestations were diarrhea (33%) and skin infection (16%). Twenty-seven patients (15%) died within 30 days. Compared with patients with bacteremia due to other Campylobacter species, patients with C. fetus bacteremia were older (mean age, 69.5 years vs. 55.6 years; [Formula: see text]) and were more likely to have cellulitis (19% vs. 7%; [Formula: see text]), endovascular infection (13% vs. 1%; [Formula: see text]), or infection associated with a medical device (7% vs. 0%; [Formula: see text]). Independent risk factors for death were cancer (odds ratio [OR], 5.1; 95% confidence interval [CI], 1.2-20.8) and asymptomatic infection (OR, 6.7; 95% CI, 1.5-29.4) for C. fetus bacteremia, the absence of prescription of appropriate antibiotics (OR, 12.2; 95% CI, 0.9-157.5), and prescription of third-generation cephalosporins (OR, 10.2; 95% CI, 1.9-53.7) for bacteremia caused by other species.

Conclusion. Campylobacter bacteremia occurs mainly in immunocompromised patients. Clinical features and risk factors of death differ by infection species.

PubMed

National trends in ambulatory visits and antibiotic prescribing for skin and soft-tissue infections.

2008-08-04T00:59:00.000-07:00

National trends in ambulatory visits and antibiotic prescribing for skin and soft-tissue infections.

Arch Intern Med. 2008 Jul 28

Hersh AL, Chambers HF, Maselli JH, Gonzales R.
Department of Pediatrics, University of California, San Francisco, 3333 California St, San Francisco, CA 94143-0936, USA. hershad@peds.ucsf.edu

BACKGROUND: Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) has emerged as a common cause of skin and soft-tissue infections (SSTIs) in the United States. It is unknown whether this development has affected the national rate of visits to primary care practices and emergency departments (EDs) and whether changes in antibiotic prescribing have occurred.

METHODS: We examined visits by patients with SSTIs to physician offices, hospital outpatient departments, and EDs using the National Ambulatory Medical Care Survey and National Hospital Ambulatory Medical Care Survey from 1997 to 2005. We estimated annual visit rates for all SSTIs and a subset classified as abscess/cellulitis. For abscess/cellulitis visits, we examined trends in characteristics of patients and clinical settings and in antibiotic prescribing.

RESULTS: Overall rate of visits for SSTIs increased from 32.1 to 48.1 visits per 1000 population (50%; P = .003 for trend), reaching 14.2 million by 2005. More than 95% of this change was attributable to visits for abscess/cellulitis, which increased from 17.3 to 32.5 visits per 1000 population (88% increase; P < .001 for trend). The largest relative increases occurred in EDs (especially in high safety-net-status EDs and in the South), among black patients, and among patients younger than 18 years. Use of antibiotics recommended for CA-MRSA increased from 7% to 28% of visits (P < .001) during the study period. Independent predictors of treatment with these antibiotics included being younger than 45 years, living in the South, and an ED setting.

CONCLUSIONS: The incidence of SSTIs has rapidly increased nationwide in the CA-MRSA era and appears to disproportionately affect certain populations. Although physicians are beginning to modify antibiotic prescribing practices, opportunities for improvement exist, targeting physicians caring for patients who are at high risk.

Archives of Internal Medicine

Six cases of Aerococcus sanguinicola infection: Clinical relevance and bacterial identification.

2008-07-13T03:47:00.000-07:00

Six cases of Aerococcus sanguinicola infection: Clinical relevance and bacterial identification.

Scand J Infect Dis. 2008 Apr

Ibler K, Jensen KT, Ostergaard C, Sonksen UW, Bruun B, Schønheyder HC, Kemp M, Dargis R, Andresen K, Christensen JJ.
From the Department of Bacteriology, Mycology and Parasitology, Statens Serum Institute, Copenhagen.

Aerococcus sanguinicola is a Gram-positive coccus first described in 2001. Infections in humans are rare but the use of 16S rRNA gene sequencing and improved phenotypic methods has facilitated the identification of A. sanguinicola. We report here 6 cases of A. sanguinicola bacteraemia, 2 of which were associated with infective endocarditis. Most patients were elderly (median age 70 y) and had underlying neurological disorders including dementia, cerebral degeneration, and myelomeningocele. The primary focus of infection was the urinary tract in 3 cases and the gallbladder in 1; no focus was detected in 2 cases. Long-term prognosis was poor reflecting the frailty of the patients. All strains were susceptible to penicillin, ampicillin, cefuroxime, vancomycin, erythromycin, and rifampicin. The optimal treatment of infection with A. sanguinicola has yet to be determined.

InformaWorld

Bacterial superinfection in upper respiratory tract infections estimated by increases in CRP values: A diagnostic follow-up in primary care.

2008-07-13T03:44:00.000-07:00

Bacterial superinfection in upper respiratory tract infections estimated by increases in CRP values: A diagnostic follow-up in primary care.
Scand J Prim Health Care. 2008 Jul

Lingard H, Zehetmayer S, Maier M.
Department of General Practice and Family Medicine, Medical University Vienna, Vienna, Austria.

Objective.

The aim of this study was to estimate the rate of bacterial superinfection in patients with URTI by using on-site determination of C-reactive protein (CRP). Design. A prospective cohort study.

Setting.

A total of 30 primary care practices. Subjects. Patients with URTI. Intervention. The CRP value was determined at the first consultation and at a follow-up within 3-5 days. CRP values of 30 units (mg) or higher were considered to be an indication of bacterial involvement. Main outcome measures. CRP values during follow-up and duration of illness.

Results.

Among the 506 patients included, 73.1% exhibited a CRP value below the defined limit at their first visit and were considered to suffer from URTI of viral origin. The rate of subsequent bacterial superinfection was 8.1%. Compared with patients suffering from URTI of bacterial or viral origin the duration of illness in patients with bacterial superinfection was significantly longer.

Conclusion.

During follow-up of patients with URTI, the prevalence of bacterial superinfection detected by using a near patient CRP determination is surprisingly low. This result should help to reduce the prescription rate of antibiotics in primary care.

InformaWorld

Epidemic typhus

2008-06-29T05:04:00.000-07:00

Epidemic typhus
Lancet Infect Dis. 2008 Jul

Bechah Y, Capo C, Mege JL, Raoult D.
Unit for Research on Emergent and Tropical Infectious Diseases (URMITE), CNRS-IRD UMR 6236, Faculty of Medicine, University of the Mediterranean, Marseille, France.

Epidemic typhus is transmitted to human beings by the body louse Pediculus humanus corporis. The disease is still considered a major threat by public-health authorities, despite the efficacy of antibiotics, because poor sanitary conditions are conducive to louse proliferation. Until recently, Rickettsia prowazekii, the causal agent, was thought to be confined to human beings and their body lice. Since 1975, R prowazekii infection in human beings has been related to contact with the flying squirrel Glaucomys volans in the USA. Moreover, Brill-Zinsser disease, a relapsed form of epidemic typhus that appears as sporadic cases many years after the initial infection, is unrelated to louse infestation. Stress or a waning immune system are likely to reactivate this earlier persistent infection, which could be the source of new epidemics when conditions facilitate louse infestation. Finally, R prowazekii is a potential category B bioterrorism agent, because it is stable in dried louse faeces and can be transmitted through aerosols. An increased understanding of the pathogenesis of epidemic typhus may be useful for protection against this bacterial threat.

PubMed

Management of periprosthetic infection

2008-06-29T04:57:00.000-07:00

Management of periprosthetic infection
Chirurg. 2008 Jun 27

Friesecke C, Wodtke J.
c/o ENDO-Klinik, Holstenstraße 2, 22767, Hamburg, Deutschland, christian.friesecke@endo.de.

Periprosthetic infection is a permanent risk and severe complication in joint arthroplasty. Systematic diagnostics under optimal conditions are necessary for a successful therapy. Patient history, clinical examination and an elevated CRP-level is the basis for suspicion of infection. The diagnosis is confirmed by identification of the pathogen from a sample collected through joint aspiration under sterile conditions. The microbiological examination is done in a laboratory specialized in the diagnosis of foreign body infections. The pattern of resistance of the identified pathogen determines the topical and systemic course of antibiotics. Surgical treatment is characterized by exchange of the prosthesis and radical debridement. The exchange can be carried out in one or two stages. The one-stage exchange offers several advantages compared to two or more stage procedures for all those involved - patient, surgeon and health care system - while providing the same chance of successful elimination of infection, with even better functional results.

Springerlink

Neglected infections of poverty in the United States of america.

2008-06-27T03:41:00.000-07:00

Neglected infections of poverty in the United States of america.

PLoS Negl Trop Dis. 2008 Jun

Hotez PJ.
Department of Microbiology, Immunology, and Tropical Medicine, The George Washington University and Sabin Vaccine Institute, Washington, D.C., United States of America.

In the United States, there is a largely hidden burden of diseases caused by a group of chronic and debilitating parasitic, bacterial, and congenital infections known as the neglected infections of poverty. Like their neglected tropical disease counterparts in developing countries, the neglected infections of poverty in the US disproportionately affect impoverished and under-represented minority populations.

The major neglected infections include the helminth infections, toxocariasis, strongyloidiasis, ascariasis, and cysticercosis; the intestinal protozoan infection trichomoniasis; some zoonotic bacterial infections, including leptospirosis; the vector-borne infections Chagas disease, leishmaniasis, trench fever, and dengue fever; and the congenital infections cytomegalovirus (CMV), toxoplasmosis, and syphilis.

These diseases occur predominantly in people of color living in the Mississippi Delta and elsewhere in the American South, in disadvantaged urban areas, and in the US-Mexico borderlands, as well as in certain immigrant populations and disadvantaged white populations living in Appalachia.

Preliminary disease burden estimates of the neglected infections of poverty indicate that tens of thousands, or in some cases, hundreds of thousands of poor Americans harbor these chronic infections, which represent some of the greatest health disparities in the United States.

Specific policy recommendations include active surveillance (including newborn screening) to ascertain accurate population-based estimates of disease burden; epidemiological studies to determine the extent of autochthonous transmission of Chagas disease and other infections; mass or targeted treatments; vector control; and research and development for new control tools including improved diagnostics and accelerated development of a vaccine to prevent congenital CMV infection and congenital toxoplasmosis.

PLoS

Anti-infective treatment of bacterial urinary tract infections.

2008-06-10T07:41:00.000-07:00

Anti-infective treatment of bacterial urinary tract infections.

Curr Med Chem. 2008

Wagenlehner FM, Pilatz A, Naber KG, Perletti G, Wagenlehner CM, Weidner W.
Department of Urology and Pediatric Urology, Justus-Liebig-University, Giessen, Germany. Wagenlehner@AOL.com.

Bacterial urinary tract infections (UTI) are frequently found in the outpatient as well as in the nosocomial setting. The bacterial UTI can be stratified into uncomplicated and complicated UTI. Antibiotic resistance is continuously increasing in uncomplicated as well as complicated UTI. In uncomplicated UTI efforts are made to use antibiotic substances exclusively for this indication. In complicated UTI as broad spectrum antibiotics are increasingly used, the higher the antimicrobial resistance rates are reported. There are two predominant aims in the antimicrobial treatment of both uncomplicated and complicated UTI: 1.) rapid and effective response to therapy, prevention of complications and prevention of recurrence in the individual patient treated, and 2.) prevention of emergence of resistance to anti-infective agents in the microbial environment. The use of antibiotics has to keep up with the continuous change in antimicrobial resistance and the tailored needs in the individual patient.

Antibiotic substances therefore need to become evaluated for each indication and continuously followed for clinical usage. The knowledge of structure-activity relationships of antimicrobial substances and bacterial resistance mechanisms to antibiotics help to use antibiotics better in daily routine and design new derivatives and substances. The aim of this review is to describe the chemistry and structure-activity relationships of current antibiotics and promising substances in development for the treatment of UTI.

PMID: 18537619 [PubMed - in process]

Infectious complications in patients with Hodgkin's lymphoma of unfavourable prognosis

2008-05-14T05:02:00.000-07:00

Infectious complications in patients with Hodgkin's lymphoma of unfavourable prognosis

Antibiot Khimioter. 2007

Analysis of the infectious complications in 48 primary patients with Hodgkin's lymphoma of infavourable prognosis recorded within 1998-2006 is presented. Respiratory tract infections, mucositis and Herpes infection were stated in 43, 24 and 22% of the patients respectively. Bacterial infections predominated (61% of the patients), then followed viral and fungal infections (26 and 43% of the patients respectively). Associations of bacterial and fungal infections were most frequent (50% of the patients). Associations of bacterial and viral infections were less frequent (30%) and fungal and viral infection associations were revealed in 20% of the patients. The structure of the bacterial, viral and fungal infections and the dynamics of the pathogen spectra are presented. The results of the analysis showed that the infections were frequent complications in such patients and could be due not only to obligate but also to opportunistic pathogens, that requires design of the diagnostic algorithm for prediction of the complication process and outcome, thus improving the remote results of the treatment.

PMID: 18461807 [PubMed - in process]

Necrotizing skin and soft-tissue infections associated with septicemia: 7 cases report and review.

2008-04-22T06:17:00.000-07:00

Necrotizing skin and soft-tissue infections associated with septicemia: 7 cases report and review.
J Med Assoc Thai. 2008 Jan

Thaichinda S, Kositpantawong N.
Division of Dermatology, Department of Medicine, Hat Yai Hospital, Songkhla, Thailand. bombergirl_16@hotmail.com

The authors report seven cases of necrotizing skin and soft-tissue infections, with clinical presenting as hemorrhagic bullae, gangrenous cellulitis or necrotizing fasciitis, in association with septicemia, between January 2003 and January 2007 in Hat Yai Hospital. Six were male and the majority of the lesions, six cases, occurred in the lower extremities. The average age of the patients was 50.0 +/- 11.019 years old. All patients presented with watery diarrhea, severe abdominal pain, high fever and sepsis. The skin lesions were begun with erythema, tender and swelling with formation of hemorrhagic bullae, gangrene and necrosis within 24-48 hours. Three of them were caused by Streptococcus spp., another three by Halophilic Vibrios, and only one by Aeromonas hydrophila. Furthermore, the literatures related with clinical manifestations of necrotizing skin and soft-tissue infections, etiologic pathogens, histological finding, management in setting of sepsis, comorbid conditions, complications and patients' outcome were reviewed.

PubMed

Late onset group B Streptococcus infection: 7 year experience in a tertiary hospital (2000-2006)

2008-03-27T09:13:00.000-07:00

Late onset group B Streptococcus infection: 7 year experience in a tertiary hospital (2000-2006)

An Pediatr (Barc). 2008 Mar

Prieto Tato LM, Gimeno Díaz de Atauri A, Aracil Santos J, Omeñaca Teres F, Del Castillo Martín F, de José Gómez MI.
Servicio de Enfermedades Infecciosas Infantil. Hospital Universitario La Paz. Madrid. España.

INTRODUCTION: Group B Streptococcus (GBS) is a major cause of neonatal infection. Two forms of the disease have been described according to the age of presentation: early, beginning in the first 6 days of life, and late, occurring from day 7 up to 3 months of age.

OBJECTIVES: To analyze the epidemiology of the late onset form of GBS disease in a tertiary hospital after implementing preventive strategies aimed to reduce the rate of vertical transmission. METHODS: We retrospectively reviewed the medical records of children diagnosed with late GBS infection between January 2000 and December 2006. Diagnostic criteria included a positive blood culture and/or a positive cerebrospinal fluid (CSF) culture for GBS in any patient aged between 7 and 89 days.

RESULTS: 24 patients were identified, most of them presenting after January 2005. Median age was 36.2 days (range 9 to 81). GBS isolates in blood were found in 20 patients, 1 in CSF and 3 in both. Most frequently children presented with fever (70.8 %) and irritability (54.1 %). Five patients (20.8 %) had a cellulitis-adenitis syndrome. Cefotaxime and ampicillin were the most often used antibiotic combination. No ampicillin resistances were found.

CONCLUSIONS: The number of children with late GBS disease has increased in our center. Accordingly, the recent recommendations for the prevention of perinatal GBS vertical transmission were not effective for reducing late GBS infection. This may be due to horizontal infections from maternal sources, community or cross infections. It is important to maintain clinical suspicion of late GBS infection and start early antibiotic treatment.

Keywords: Group B Streptococcus. Late onset disease. Horizontal transmission.

Annals of Pediatric

The Management of Clostridium difficile Infection: Antibiotics, Probiotics and Other Strategies

2008-03-23T00:31:00.000-07:00

The Management of Clostridium difficile Infection: Antibiotics, Probiotics and Other Strategies

J Chemother. 2008 Feb

Senok AC, Rotimi VO.

Clostridium difficile-associated disease remains an important nosocomial infection associated with significant morbidity and mortality. In recent years, there has been an upward trend in the incidence of this condition with continuing high rates of recurrent disease with available treatment regimens. In this article, we review the current literature on the management of C. difficile-associated disease (CDAD). The potential role for alternative therapeutic options for the treatment of CDAD, including the use of bacteriotherapy in the form of probiotics, immunotherapy and ion-exchange resins as well as new drugs under investigation is explored.

The evidence indicates a need for innovative approaches to the management of this condition. The combined use of antibiotic therapy and replacement of gut microbiota using probiotics remains promising and we suggest a multi-pronged approach in the management of this challenging infection.

Journal of Chemotherapy

The evaluation and treatment of complicated skin and skin structure infections

2008-03-23T00:25:00.000-07:00

The evaluation and treatment of complicated skin and skin structure infections

April 2008

Exper Opinion on Parhmacotherapy

Paul B Cornia‌1,2 MD, Heather L Davidson‌1 MD & Benjamin A Lipsky‌1 MD
1University of Washington School of Medicine, Primary and Specialty Medicine Service, Veterans Affairs Puget Sound Health Care System and Department of Medicine, Seattle, WA 98108-1597, USA
2Assistant Professor of Medicine University of Washington, VA Puget Sound Health Care System (S-111), 1660 South Columbian Way, Seattle, WA 98108-1597, USA +1 206 764 2551; +1 206 764 2936; paul.cornia@med.va.gov
Background:

Skin and skin structure infections are frequently encountered in clinical practice. Fortunately, these infections usually produce only mild to moderate symptoms and signs. Some, however, are severe and may even be life-threatening.

Objective:

To review the approach to the evaluation and treatment of patients with complicated skin and skin structure infections and to discuss when to consider using either established antibiotics or recently licensed agents for treating these infections.

Methods:

In addition to a non-systematic literature review of complicated skin and skin structure infections and necrotizing fasciitis, we identified recent articles examining the microbiology and describing recently licensed antibiotics for treating these infections.

Results/conclusions:

Clinicians must learn to recognize the early symptoms and signs of severe skin and skin structure infections to ensure they select appropriate empiric antibiotic therapy and, when needed, obtain prompt surgical consultation. While the recent approvals of new agents for treating these infections are welcome, particularly in light of the continued emergence of antibiotic-resistant bacteria, traditional antibiotic regimens remain appropriate for most cases.

Expert Opinion

Early neonatal bacterial infections: Could superficial bacteriologic samples at birth be limited?]

2008-03-20T17:07:00.000-07:00

Early neonatal bacterial infections: Could superficial bacteriologic samples at birth be limited?

Arch Pediatr. 2008 Mar 10

Noguer Stroebel A, Thibaudon C, Dubos JP, Djavadzadeh-Amini M, Husson MO, Truffert P.
Service de pédiatrie en maternité, pôle d’obstétrique, hôpital Jeanne-de-Flandre, CHRU de Lille, 2, rue Oscar-Lambert, 59037 Lille cedex, France.

INTRODUCTION: Without promptly started antibiotic therapy, early neonatal bacterial infections incur a significant mortality. Superficial bacteriologic samples at birth have in France a real place for the diagnosis and the decision to treat a neonate. OBJECTIVES: In order to limit their indication and their choice, the aim of this article was to describe the proportion of neonates with samples and to determine the diagnostic value of the gastric aspirate, the ear swab and the placental sample.

METHODS: Neonates born in the CHRU of Lille in 2005 and staying in the maternity ward were prospectively included. Criteria for samples, type of samples and diagnosis taken were noted. Sensibility, specificity, positive and negative predictive values and likelihood ratios for a positive test and a negative test were calculated.

RESULTS AND CONCLUSION: This study included 3918 neonates; 1.7% (65 children) were infected according to our criteria; 42.3% received bacteriologic samples. In accordance with the Anaes guidelines (2002), if mothers were Group B Streptoccocci positive and received intrapartum antibiotics (up to 2 injections) or did not have any screening test whithout any other indication of samples, the neonate did not have to receive bacteriologic samples. The gastric aspirate was the best exam thanks to the excellent negative predictive value of its direct examination: 99.4% (IC 95%: 98.8-99.7), its high likelihood ratio for a positive test: 10.04 (IC 95%: 8.29-12.15) and its low likelihood ratio for a negative test: 0.16 (IC 95%: 0.09-0.29); this sample could restrict the antibiotics' ratio given to the neonate. Placental sample could be taken only in certain indications.

Elsevier

Management of common bacterial infections of the skin

2008-03-14T04:57:00.000-07:00

Management of common bacterial infections of the skin

Curr Opin Infect Dis. 2008 Apr

Bernard P.
Department of Dermatology, Robert Debré Hospital, Reims, France.

PURPOSE OF REVIEW: Bacterial skin infections commonly encountered in the community include impetigo, folliculitis/furunculosis, simple abscesses, erysipelas and other nonnecrotizing cellulitis. The review focuses on recent epidemiological, bacteriological and therapeutic advances.

RECENT FINDINGS: Impetigo and erysipelas occur in about 20 and 1 person/1000/year, respectively. Main risk factors for erysipelas are toe-web intertrigo and lymphedema. The true incidence of furunculosis is unknown, whereas outbreaks in small communities are reported worldwide. Staphylococcus aureus is the predominant pathogen for impetigo and furunculosis, and methicillin-resistant strains play a growing role in both diseases.

Erysipelas are mainly caused by streptococci, whereas local complications (i.e. abscesses or blisters) may be due to staphylococci, including methicillin-resistant strains in involved geographic areas. Recent trends for treating impetigo and furunculosis predate community-acquired methicillin-resistant S. aureus.

For outbreaks of furunculosis, stringent decolonization measures are showing promise, whereas there is no validated therapeutic regimen for chronic furunculosis.

Current trends for erysipelas involve ambulatory treatments and reduced duration of antibiotics.

SUMMARY: Despite better epidemiological or bacteriological knowledge of common bacterial skin infections, the exact role of methicillin-resistant staphylococci needs regular surveys in involved geographic areas. Antibiotic treatment must be active on staphylococci and, to a lesser degree, on streptococci.

Lippincott, Williams & Wilkins

Serum markers in community-acquired pneumonia and ventilator-associated pneumonia

2008-03-05T21:08:00.000-08:00

Serum markers in community-acquired pneumonia and ventilator-associated pneumonia

Curr Opin Infect Dis. 2008 Apr

Póvoa P.
Faculty of Medical Sciences, New University of Lisbon, Medical Intensive Care Unit, Department of Medicine, São Francisco Xavier Hospital, Lisbon, Portugal.

PURPOSE OF REVIEW: This article reviews recent data on the usefulness of serum markers in community-acquired pneumonia and ventilator-associated pneumonia. The focus is on clinical studies, with an emphasis on adult critically ill patients.

RECENT FINDINGS: Serum markers have demonstrated potential value in early prediction and diagnosis of pneumonia, in monitoring the clinical course and in guiding antibiotic therapy. C-reactive protein appears to perform better in diagnosing infection, because several studies have shown that procalcitonin may remain undetectable in some patients, specifically those with pneumonia. Procalcitonin exhibited a better correlation with clinical severity, however. Furthermore, one report demonstrated the efficacy and safety of procalcitonin-guided antibiotic therapy in community-acquired pneumonia.

SUMMARY: Serum markers should only be used as a complementary tool to support the current clinical approach. Use of serum markers, in particular procalcitonin and C-reactive protein, represents a promising strategy in the clinical decision-making process in patients in whom pneumonia is suspected. Specifically, these markers can be used to guide culture sampling and empirical antibiotic prescription, and to monitor the clinical course, adjust the duration of antibiotic therapy and identify nonresponders, in whom an aggressive diagnostic and therapeutic approach may prevent further clinical deterioration.

Lippincott, Williams & Wilkins

What is healthcare-associated pneumonia and how is it managed?

2008-03-05T21:01:00.000-08:00

What is healthcare-associated pneumonia and how is it managed?

Curr Opin Infect Dis. 2008 Apr

Carratalà J, Garcia-Vidal C.
Infectious Disease Service, Hospital Universitari de Bellvitge, Institut dʼInvestigació Biomèdica de Bellvitge (IDIBELL), University of Barcelona, LʼHospitalet de Llobregat, Barcelona, Spain.

PURPOSE OF REVIEW: Pneumonia developing before hospital admission in patients in close contact with the health system was recently termed 'healthcare-associated pneumonia' and proposed as a new category of respiratory infection. We focus on the recent literature concerning the epidemiology, causative organisms, antibiotic susceptibilities, and outcomes of and empirical antibiotic therapy for this condition.

RECENT FINDINGS: The reported incidence of healthcare-associated pneumonia among patients requiring hospitalization for pneumonia ranges from 17% to 67%. Hospitalization within 90 days before pneumonia, attending a dialysis clinic and residing in a nursing home were the most common criteria for healthcare-associated pneumonia. Compared with patients with community-acquired pneumonia, those with healthcare-associated pneumonia are older, have greater co-morbidity, and are more likely to have aspiration pneumonia and pneumonia caused by antibiotic-resistant pathogens. Patients with healthcare-associated pneumonia also more frequently initially receive an inappropriate antibiotic therapy, have higher case fatality rates and have longer hospital stay.

SUMMARY: Many patients hospitalized with pneumonia via the emergency department have healthcare-associated pneumonia. There are significant differences in the spectrum of causative organisms and antibiotic susceptibilities between healthcare-associated and community-acquired pneumonia. Physicians should differentiate patients with healthcare-associated pneumonia from those with community-acquired pneumonia to promote a targeted approach when selecting initial antibiotic therapy.

Lippincott, Williams & Wilkins

Diphtheria

2008-03-02T19:14:00.000-08:00

Diphtheria

Basic Fact Sheet - 2007

Description

Diphtheria is an acute bacterial disease caused by toxigenic strains of Corynebacterium diphtheriae. There are four biotypes: gravis, mitis, intermedius and belfanti (1). Toxin-producing strains of C. ulcerans may also cause a diphtheria-like illness. The disease affects the mucous membranes of the respiratory tract (respiratory diphtheria), the skin (cutaneous diphtheria), and occasionally mucous membranes at other sites (eyes, ears, or vagina).

Cutaneous diphtheria is common in tropical countries (2). Humans are the only known reservoir of C. diphtheriae. Diphtheria is transmitted to close contacts by respiratory droplets or by direct contact with discharge from skin lesions, and rarely from fomites. Raw milk or dairy products have been reported as vehicles for transmission (3).

Occurrence

Diphtheria is sporadically reported in the US and the last case occurred in an elderly traveler immediately after returning to the US from a country with endemic diphtheria (4). However, the disease can cause morbidity and mortality in developing countries where childhood vaccination coverage is low (5). Large outbreaks of diphtheria occurred in the 1990s throughout Russia and the newly independent states of the former Soviet Union (6). In the Americas, diphtheria was more recently reported from Paraguay, the Dominican Republic, and Haiti (5). Countries with endemic diphtheria (5) are shown in the Table 4-1.

Risk for Travelers

Travelers to countries with endemic diphtheria are at a higher risk of disease following exposure to toxigenic C. diphtheriae if they are inadequately immunized or not up-to-date with diphtheria booster immunizations. Although immunization does not prevent colonization or carriage of C. diphtheriae, symptomatic, or clinically evident infection is extremely rare in adequately immunized persons. Most cases occur in unvaccinated or inadequately immunized persons (7–9).

Clinical Presentation

The incubation period is 2-5 days (range 1-10 days), and the onset of symptoms is gradual. Early symptoms of respiratory diphtheria include malaise, sore throat, difficulty in swallowing, loss of appetite, and a mild fever (rarely >101° F). If the larynx is involved, the affected person may become hoarse. Within 2–3 days, an adherent, gray membrane forms over the mucous membrane of the tonsils, pharynx, or both. Attempts to remove the membrane cause bleeding. In severe cases of respiratory diphtheria, cervical lymphadenopathy and soft tissue swelling in the neck give rise to a “bull-neck” appearance (10). Extensive membrane formation may result in life-threatening or fatal airway obstruction. Diphtheria toxin can cause serious systemic complications, including myocarditis and neuropathies, if it is absorbed from the site of infection. Cutaneous and nasal diphtheria are localized infections that are rarely associated with systemic toxicity. The case-fatality rate of respiratory diphtheria is 5%-10%.

Prevention

VACCINE

Routine Immunizations for Infants and Children <7>

Immunization for infants and children up to the seventh birthday consists of five doses of DTaP vaccine. The first three doses are usually given at ages 2, 4 and 6 months, the fourth dose at ages 15-18 months, and the fifth dose at ages 4-6 years. The fifth dose is not necessary if the fourth dose was given after the child’s fourth birthday (11).

Travelers should be advised to complete as many doses as possible of the primary series before traveling. At least three doses of DTaP are necessary for protection against diphtheria. If an accelerated schedule is required to complete the series of DTaP vaccine, the schedule may be started as soon as the infant is 6 weeks of age, with the second and third doses given 4 weeks after each preceding dose (Table 8-4). The fourth dose should not be given before the child is 12 months of age and should be separated from the third dose by at least 6 months. The fifth dose should not be given before the child is age 4 years. Interruption of the recommended schedule or delay in doses does not lead to a reduction in the level of immunity reached on completion of the primary series. There is no need to restart a series regardless of the time that has elapsed between doses. For infants and children older than 7 years with a contraindication to the pertussis component of DTaP, diphtheria-tetanus (DT) can be used (11) (Tables 8-2, 8-3 and 8-4).

Primary Immunizations for Children ≥7 Years of Age, Adolescents, and Adults
There is no pertussis-containing vaccine licensed for children 7 to 9 years of age. In 2005, two tetanus toxoid, reduced diphtheria toxoid, and acellular pertussis (Tdap) vaccines were licensed for use by the FDA. BOOSTRIX (GlaxoSmith-Kline Biologicals) has been licensed for use in people 10-18 years old and ADACEL (Sanofi Pasteur) has been licensed for use in people 11-64 years old (12).

Children 7–9 years of age who have not received a primary series against tetanus and diphtheria should receive three doses of Td because no pertussis-containing vaccine is licensed for use in this age group (11). If a child is 10 years old, a single dose of BOOSTRIX may be substituted for one of the Td doses.

Persons older than 11 years of age who have never been vaccinated against tetanus, diphtheria or pertussis (no dose of pediatric DTP/DTaP/DT/ or Td) should receive three doses of a tetanus and diphtheria toxoid-containing vaccine. For persons 11–64 years of age, the preferred schedule is a single Tdap dose, followed by a dose of Td given 4-8 weeks later. A second dose of Td is given at 6–12 months after the earlier Td dose. Two doses of a Td-containing vaccine can provide some protection against diphtheria, but a single dose is of little benefit. In the rare instance when vaccine administration following a 6–12-month interval cannot be ensured, an interval of 4-8 weeks may be used to complete the primary series (12,13).

Anyone whose history of primary tetanus and diphtheria vaccination is uncertain should be considered unvaccinated and should receive the three-dose series. Anyone who has received only one or two prior doses of tetanus and diphtheria toxoids should receive additional dose(s) to complete the three-dose series. A single dose of Tdap can be substituted for any of the Td doses (11,12).

Booster Immunizations for Children ≥7 Years of Age, Adolescents, and Adults

Adolescents 11–18 years of age should receive a single dose of Tdap instead of Td for booster immunization against tetanus, diphtheria, and pertussis if they have completed the recommended childhood DTwP/DTaP vaccination series. Thereafter, routine booster doses of Td vaccine should be given at 10-year intervals (11,12). This is especially important for travelers who will be living or working with local populations in countries where diphtheria is endemic.

Adults 19–64 years of age should receive a single dose of Tdap (ADACEL) to replace a single dose of Td for active booster immunization against tetanus, diphtheria and pertussis, if they received their last dose of Td more than 10 years earlier and have not previously received a dose of Tdap. Replacing one dose of Td with Tdap should reduce the morbidity associated with pertussis in adults and may reduce the risk of transmitting pertussis to persons at increased risk for pertussis and its complications (13). Tdap is not licensed or recommended for adults 65 years of age and older, who should receive Td instead.

Adverse Reactions

Local reactions (erythema and induration with or without tenderness) are common after the administration of vaccines containing diphtheria, tetanus, and pertussis antigens (DTaP, TD, Td, Tdap) (11,12). Mild systemic reactions such as drowsiness, fretfulness, and low-grade fever can occur after vaccination with DTaP. These reactions are self-limited and can be managed with symptomatic treatment of acetaminophen or ibuprofen. Swelling involving the entire thigh or upper arm has occurred after the fourth and fifth doses of DTaP. These reactions are also self limited (11).

Anaphylactic and other serious adverse reactions are rare after receipt of preparations containing diphtheria, tetanus or pertussis components, or a combination of these. Arthus-type hypersensitivity reactions, characterized by severe local reactions, have been reported in adults who received frequent boosters of tetanus or diphtheria toxoids (11).

Precautions and Contraindications

An immediate anaphylactic reaction to a prior dose of vaccine or vaccine component is a contraindication to further vaccination with DTaP, DT, Tdap, or Td. Encephalopathy not due to another identifiable cause within 7 days of vaccination is a contraindication to further vaccination with a pertussis-containing vaccine. DT or Td may be substituted for DTaP or Tdap, respectively.

Moderate or severe acute illness is a precaution to vaccination. Mild illnesses, such as otitis media or upper respiratory infection, are not contraindications. Anyone for whom vaccination is deferred because of moderate or severe acute illness should be vaccinated when the condition improves.

Development of Guillain-Barré syndrome 6 weeks or less after a previous dose of a tetanus toxoid-containing vaccine is considered a precaution. Risks and benefits of immunization should be evaluated by the vaccine provider before administering Td or Tdap. Certain infrequent adverse events following pertussis vaccination are considered precautions (not contraindications) to additional doses of DTaP but not to Tdap: a seizure, with or without fever, occurring within 3 days of immunization; temperature higher than 40.5° C (105° F) not resulting from another identifiable cause within 48 hours of immunization; collapse or a shock-like state (hypotonic-hyporesponsive episode) within 48 hours of immunization, or persistent, inconsolable crying lasting longer than 3 hours and occurring within 48 hours of immunization. These events have not been demonstrated to cause permanent sequelae. In certain circumstances (e.g., during a communitywide outbreak of pertussis), the benefit of additional vaccination with DTaP in children or Tdap in adults may outweigh the risk of another reaction.

Progressive neurologic conditions characterized by changing developmental findings are considered contraindications to receipt of pertussis vaccine. Such disorders include infantile spasms and other epilepsies beginning in infancy (3). Infants and children with stable neurologic conditions such as cerebral palsy or controlled seizures should be vaccinated.

Treatment

The diagnosis is usually presumptive, based on clinical features. A definitive diagnosis is based on a positive culture of C. diphtheriae from a throat swab, membrane. Toxin production is confirmed by performing a modified Elek test.

Patients with respiratory diphtheria require hospitalization, immediate treatment with diphtheria antitoxin (DAT), appro-priate antibiotics and supportive care, and monitoring of their close contacts (14,15).

References

Funke F, von Graevenitz A, Clarridge JE 3rd, Bernard KA. Clinical microbiology of coryneform bacteria. Clin Microbiol Rev. 1997;10:125-59.
Galazka AM. The immunologic basis for immunization: Diphtheria (WHO/EPI/GEN/13.13). Geneva, World Health Organization, 1993. Available at: http://whqlibdoc.who.int/hq/1993/WHO_EPI_GEN_93.13_mod2.pdf.
American Academy of Pediatrics. Diphtheria. In: Pickering LK, Baker CJ, Long SS, McMillan JA, eds. Red Book: 2006 Report of the Committee on Infectious Diseases. 27th ed. Elk Grove Village, IL: American Academy of Pediatrics; 2006:277–81.
CDC. Summary of notifiable diseases—United States, 2004. MMWR Morbid Mortal Wkly Rep. 2004;53:46.
World Health Organization. WHO vaccine-preventable diseases monitoring system: 2005 global summary. Geneva, Switzerland: World Health Organization, 2006.
Galazka A. The changing epidemiology of diphtheria in the vaccine era. J Infect Dis. 2000;181(suppl 1):S2-9.
Bisgard KM, Hardy IRB, Popovic T, Strebel PM, Wharton M, Chen RT, et al. Respiratory diphtheria in the United States, 1980 through 1995. Am J Public Health. 1998;88:787–91.
CDC. Fatal respiratory diphtheria in a U.S. traveler to Haiti—2003. MMWR Morbid Mortal Wkly Rep. 2003;52:1285–6.
CDC. Diphtheria acquired by U.S. citizens in the Russian Federation and Ukraine—1994. MMWR Morbid Mortal Wkly Rep. 1995; 44:243–4.
Wharton M, Vitek CR. Diphtheria toxoid. In: Plotkin SA, Orenstein WA, eds. Vaccines. 4th ed. Philadelphia: W.B. Saunders; 2004:211–28.
CDC. General recommendations on immunizations: recommendations of the Advisory Committee on Immunization Practices (ACIP) and the American Academy of Family Physicians (AAFP). MMWR Recomm Rep. 2002;51(RR-2):1–35.
CDC. Preventing tetanus, diphtheria, and pertussis among adolescents: use of tetanus toxoid, reduced diphtheria toxoid and acellular pertussis vaccines: recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recommm Rep. 2006;55(RR-3):1–50.
CDC. ACIP Votes to Recommend Use of Combined Tetanus, Diphtheria and Pertussis (Tdap) Vaccine for Adults. Available at PDF (Accessed on August 11, 2006.
Farizo KM, Strebel PM, Chen RT, Kimbler A, Cleary TJ, Cochi SL. Fatal respiratory disease due to Corynebacterium diphtheriae: case report and review of guidelines for management, investigation, and control. Clin Infect Dis. 1993;16:59-68.
CDC. Notice to Readers: Availability of diphtheria antitoxin through an Investigational New Drug protocol. MMWR Morbid Mortal Wkly Rep. 2004;53:413.

CDC

Effect and Mechanism of Andrographolide on the Recovery of Pseudomonas aeruginosa Susceptibility to Several Antibiotics

2008-03-01T18:57:00.000-08:00

Effect and Mechanism of Andrographolide on the Recovery of Pseudomonas aeruginosa Susceptibility to Several Antibiotics

J Int Med Res. 2008 Jan-Feb

Wu CM, Cao JL, Zheng MH, Ou Y, Zhang L, Zhu XQ, Song JX.
Department of Liver Diseases, The Traditional Chinese Medical Hospital of Wenzhou, Wenzhou, China.

Effectiveness and mechanism of action of andrographolide on the recovery of Pseudomonas aeruginosa susceptibility to antibiotics was investigated. In the presence of andrographolide, the Mueller-Hinton broth dilution method measured minimal inhibitory concentrations (MIC) of ceftazidine, cefpirome, chloramphenicol, L-ofloxacin, kanamycin, imipenem and meropenem. Real-time fluorescence quantitative polymerase chain reaction was used to determine mexB mRNA expressions in P. aeruginosa PAO1 strain and MexAB-OprM overexpressing strain. Relative mexB mRNA expression was detected in both strains incubated for 3 and 9 h. When andrographolide-treated groups were compared with controls, the MIC of ceftazidine, cefpirome, L-ofloxacin and meropenem for both strains decreased, and the relative mexB mRNA expression was significantly lower, although between andrographolide groups there were no significant differences. Compared with the inactivated quorum-sensing system, relative amounts of mexB mRNA in the PAO1 strain and MexAB-OprM overexpressing strain in the activated quorum-sensing system increased 10- and 30-fold, respectively. Andrographolide recovered P. aeruginosa susceptibility to antibiotics and reduced the MexAB-OprM efflux pump expression level.

PMID: 18304418 [PubMed - in process]

Optimal treatment of hepatic abscess

2008-03-01T18:50:00.000-08:00

Optimal treatment of hepatic abscess

Am Surg. 2008 Feb

Hope WW, Vrochides DV, Newcomb WL, Mayo-Smith WW, Iannitti DA.
Department of Minimally Invasive and Gastrointestinal Surgery, Carolinas Medical Center, Charlotte, North Carolina 28203, USA.

Many treatment strategies have been proposed for pyogenic liver abscesses; however, the indications for liver resection for treatment have not been studied in a systematic manner. The purpose of our study was to evaluate the role of surgical treatment in pyogenic abscesses and to determine an optimal treatment algorithm. We retrospectively reviewed the medical records of all patients who had a pyogenic liver abscess at Rhode Island Hospital between 1995 and 2002. Abscesses and treatment strategies were classified into three groups each. The abscess groups included Abscess Type I (small <3>3 cm, unilocular), and Abscess Type III (large >3 cm, complex multilocular). The treatment strategy groups included Treatment Group A (antibiotics alone), Treatment Group B (percutaneous drainage plus antibiotics), and Treatment Group C (primary surgical therapy). Descriptive statistics were calculated and chi2 used for comparison with a P <>3 cm), multiloculated abscesses had a significantly higher success rate than percutaneous drainage plus antibiotic therapy (33% versus 100%, P < or =" 0.01)." p =" 0.40).">

PMID: 18306874 [PubMed - in process]

Extensively drug-resistant tuberculosis

2008-02-26T19:11:00.000-08:00

Extensively drug-resistant tuberculosis

Dtsch Med Wochenschr. 2008 Feb

C. Lange1, M. P. Grobusch2, D. Wagner3
1 Klinische Infektiologie, Medizinische Klinik, Forschungszentrum Borstel2 Infectious Diseases Unit, Division of Clinical Microbiology and Infectious Diseases, National Health Laboratory Services and School of Pathology, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, Südafrika3 Zentrum für Infektiologie und Reisemedizin, Medizinische Klinik, Universität Freiburg

Recently an increasing number of antibiotic-resistant MYCOBACTERIUM TUBERCULOSIS (MTB) strains have been described worldwide. The term XDR- (extensively drug-resistant) tuberculosis (TB) has been introduced by the World Health Organisation (WHO) to characterize multi-drug-resistant MTB strains that are in vitro resistant against fluorochinolones and one of the injectible substances amikacin, capreomycin or kanamycin in addition to isoniazid and rifampin. Strains of XDR-MTB are currently increasingly seen in HIV-seropositive individuals with tuberculosis in southern Africa, where these strains are passed by person-to person contact. XDR-TB has become a serious problem for the health administrations in this region. In contrast, cases of XDR-TB are only rarely seen in Germany so far, mainly among the population of pre-treated migrants from eastern Europe. The development of rapid diagnostic tests for resistance testing and new drugs for the treatment of tuberculosis has lacked support for several decades. The sudden emergence of XDR-MTB strains now warrants immediate action for the development of such tests and new classes of antibiotics to give all patients with TB a chance for a successful treatment.

Thieme Connect

Detection and inhibition of bacterial cell-cell communication

2008-02-23T04:12:00.000-08:00

Detection and inhibition of bacterial cell-cell communication
2007

Rice SA, McDougald D, Givskov M, Kjelleberg S.

Bacteria communicate with other members of their community through the secretion and perception of small chemical cues or signals. The recognition of a signal normally leads to the expression of a large suite of genes, which in some bacteria are involved in the regulation of virulence factors, and as a result, these signaling compounds are key regulatory factors in many disease processes. Thus, it is of interest when studying pathogens to understand the mechanisms used to control the expression of virulence genes so that strategies might be devised for the control of those pathogens. Clearly, the ability to interfere with this process of signaling represents a novel approach for the treatment of bacterial infections. There is a broad range of compounds that bacteria can use for signaling purposes, including fatty acids, peptides, N-acylated homoserine lactones, and the signals collectively called autoinducer 2 (AI-2). This chapter will focus on the latter two signaling systems as they are present in a range of medically relevant bacteria, and here we describe assays for determining whether an organism produces a particular signal and assays that can be used to identify inhibitors of the signaling cascade. Lastly, the signal detection and inhibition assays will be directly linked to the expression of virulence factors of specific pathogens.

PMID: 18287747 [PubMed - in process]

Pseudomonas aeruginosa Serious Infections: Mono or Combination Antimicrobial Therapy?

2008-02-22T15:15:00.000-08:00

Pseudomonas aeruginosa Serious Infections: Mono or Combination Antimicrobial Therapy?

Curr Med Chem. 2008

Bassetti M, Righi E, Viscoli C.
Infectious Diseases Division, San Martino University Hospital, Genoa, Italy. matteo.bassetti@hsanmartino.it.

P. aeruginosa is a serious cause of infection with reported rates of mortality being up to 61%. Several studies evidenced a correlation between hospital mortality due to P. aeruginosa bloodstream infections and an inappropriate antimicrobial treatment. Increasing resistance in P. aeruginosa isolates complicates the selection of adequate empirical therapy in severe infections and P. aeruginosa is often indistinguishable from other gram-negative bacterial infections. For these reasons, present guidelines for the treatment of suspected P. aeruginosa bacteraemia recommend the rapid introduction of empirical antimicrobial therapy that includes at least one antipseudomonal agent until having microbiological results. Current consensus favours the use of empirical combination, balancing the potential for greater toxicity against the lower emergence of antimicrobial resistance and the greater killing that might be achieved by combination therapies acting synergistically. Advantages and disadvantages of combination therapy towards monotherapy for P. aeruginosa severe infections, current antibiotics used for P. aeruginosa severe infections and main studies published on this issue are reviewed.

PMID: 18289007 [PubMed - in process]

Pseudomonas aeruginosa: combined treatment vs. monotherapy

Med Intensiva. 2007 Mar

Bodí M, Garnacho J.
Hospital Universitario Joan XXIII de Tarragona, Tarragona, España. mbodi.hj23.ics@gencat.net

Keywords: Pseudomonas aeruginosa, combination therapy, microbiological results.

Pseudomonas aeruginosa is a pathogen commonly encountered in clinical practice in critically ill patients. It is a serious cause of infection, associated with a high rate of morbidity and mortality. Inappropriate antimicrobial therapy and delay in starting effective antimicrobial therapy is associated with worse prognostic. This microorganism is clinically indistinguishable from others forms of gram-negative bacterial infection. The rate of multidrug-resistant P. aeruginosa has increased in the last years. For these reasons, patients with Pseudomonas infection might receive empirical antibiotics that are inactive against Pseudomonas, especially before antibiotic susceptibility results become available. It remains controversial whether combination therapy, given empirically or as definitive treatment, for suspected Pseudomonas aeruginosa infections is justifiable. In the present article, we aimed to review recent studies that have evaluated the impact of combination therapy on Pseudomonas infections outcome and we exhibit our point of view in this subject. It seems justifiable to start combination therapy with two antipseudomonal agents in patients with risk for Pseudomonas infection during the first 3-5 days, until having microbiological results. This combination therapy must be changed to monotherapy on the basis on the specific susceptibility pattern of the initial isolate. In cases without microbiological diagnosis and poor outcome, combination therapy will be maintained and other causes of infection will be studied. Multicentre prospective randomized trials in critically ill patients are needed to determine which antimicrobials combinations improve outcome in Pseudomonas infections.

Medicina Intensiva

Pseudomonas aeruginosa bloodstream infections: how should we treat them?

Int J Antimicrob Agents. 2007 N

van Delden C.
Service of Infectious Diseases, University Hospital Geneva, CH-1211 Geneva 14, Switzerland. Christian.vandelden@medecine.unige.ch

Pseudomonas aeruginosa remains a major cause of bloodstream infections associated with high mortality. Adequacy of empirical therapy seems to influence outcome. Because of its high intrinsic resistance and its capacity to develop resistance during therapy, exposure to antimicrobial therapies frequently leads to subsequent P. aeruginosa bacteraemia with resistant isolates, increasing the risk of inadequate empirical therapy. Therefore empirical therapy should not include antimicrobial agents used in the last few months. Definitive combination therapy does not influence the prognosis of P. aeruginosa bacteraemia. Similarly, empirical combination therapy does not improve survival until receipt of the antibiogram. In contrast, empirical combination therapy does improve survival from the day of receipt of antibiogram to day 30. We therefore suggest that patients suspected of P. aeruginosa bacteraemia should receive empirical combination therapy until receipt of the antibiogram, followed by downgrading to an adequate monotherapy. This strategy might reduce mortality in P. aeruginosa bloodstream infections without exposing the patient to an excessive risk of adverse events. Antimicrobial therapies might select P. aeruginosa isolates with particular virulence phenotypes. The influence of specific virulence determinants on the prognosis of P. aeruginosa bacteraemia, as well as the potential benefit of virulence inhibition, deserves further investigation.

Elsevier

Experts warn of potential dengue fever outbreak in the United States

2008-02-18T16:37:00.000-08:00

Experts warn of potential dengue fever outbreak in the United States
David Morens, MD, and Anthony Fauci, MD, caution that dengue fever could pose a significant threat to the continental United States.
by Kirsten H. EllisIDN Staff Writer

February 2008

Dengue fever and its severe forms, dengue hemorrhagic fever and dengue shock syndrome, are potential threats to residents of the continental United States, according to a recent commentary by leading health experts.

Public health officials need to be aware of the threat because no treatments or vaccines for dengue are currently available. Dengue fever is already present along the U.S.-Mexico border and in Puerto Rico.

“Clinicians should know how to identify and diagnose dengue fever. They need to be aware of dengue fever and where it can occur, which is theoretically anywhere in the United States for imported cases,” David Morens, MD, National Institute of Allergy and Infectious Diseases senior advisor, told Infectious Disease News. “Dengue fever was a common occurrence in the past and could be again where mosquito vectors are present, particularly in urban areas.”

Morens and Anthony Fauci, MD, director of National Institute of Allergy and Infectious Diseases, wrote about the threat of dengue fever in the United States in a recent edition of the Journal of the American Medical Association.

Reemergence of dengue fever

“In recent decades, dengue disease has followed vector expansion and dengue hemorrhagic fever, a deadly but poorly understood complication, has tended to follow,” Morens and Fauci wrote in their commentary. “The combined effects of global urbanization and increasing air travel are expected to make dengue fever a growing international health problem for the foreseeable future.”

Dengue fever is considered among the most important reemerging infectious diseases with an estimated 50 million to 100 million cases annually. WHO case estimates include 500,000 hospitalizations and 22,000 deaths each year, most of which occur in children.
In their commentary, Morens and Fauci outlined the background of dengue fever and the adaption and movement of its vector, Aedes aegypti, which already is established in much of the tropical and subtropical world. An alternative vector, Aedes albopictus, is spreading geographically into temperate climates, which could exacerbate the global dengue spread. Both mosquito species have been found in the United States.

“In 2001, the first dengue fever outbreak in Hawaii since World War II caused a lot of alarm, people got sick and there was great public concern,” Morens said. “We talk about ‘mild’ dengue, but people with classic dengue fever would probably dispute the word ‘mild.’”

The National Institute of Allergy and Infectious Diseases allocated $33.2 million in 2007 for nearly 60 dengue research projects, including vaccine, diagnostic and therapeutic development and clinical vaccine trials.

Dengue questions abound

Dengue fever is complex and multiple factors confound scientific answers, including risks and the lack of understanding about pathogenesis of dengue hemorrhagic fever and dengue shock syndrome.

Classic dengue fever symptoms are similar to those of influenza, but can confound diagnosis because symptoms are not predictive markers for disease severity, progression or hypotension. These variables make this virus complex and difficult to understand.

Risk for dengue hemorrhagic fever and dengue shock syndrome most often are associated with second dengue infections. However, dengue hemorrhagic fever in infants aged 5 to 8 months does not follow this pattern because the first, rather than the second infection, is more likely to progress beyond classic dengue. Risks for these more severe forms typically decrease with each subsequent infection, but this decrease also may depend on the virus serotype.

Other questions arise regarding vaccination development strategies because antibodies could decrease efficacy over time and vectors may develop resistance.

The National Institute of Allergy and Infectious Diseases’ dengue research program includes the development of animal models to gain understanding of the basic mechanisms of infection. Researchers also are working to understand how dengue viruses elicit antibodies, which is key to unlocking the mode through which viruses infect host cells. Research is underway on biological markers to gain insight into predictors of whether dengue fever will develop into dengue hemorrhagic fever or dengue shock syndrome.

Researchers also are trying to determine what causes capillaries to leak plasma in people infected with dengue hemorrhagic fever and dengue shock syndrome and investigating a possible genetic susceptibility to infection. Promising dengue vaccines have already reached phase 2 safety and efficacy testing including inactivated, live attenuated, chimeric, subunit and DNA vaccines, Morens and Fauci wrote.

For more information:

Morens DM, Fauci AS. Dengue and hemorrhagic fever: a potential threat to public health in the United States. JAMA. 2008;299:214-216.

Infectious Disease News

An antidote for Staphylococcus aureus pneumonia?

2008-02-16T05:56:00.000-08:00

An antidote for Staphylococcus aureus pneumonia?
Frank R. DeLeo and Michael Otto
F.R. DeLeo and M. Otto are at the Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, MT 59840
CORRESPONDENCE F.R.D.: fdeleo@niaid.nih.gov

ABSTRACT

Methicillin-resistant Staphylococcus aureus (MRSA) is the leading cause of bacterial infections in the United States. Severe invasive MRSA infections, which include pneumonia, are difficult to treat because the bacteria are resistant to antibiotics. A new report now shows that immunization against -hemolysin (Hla), a cytolytic toxin secreted by most S. aureus strains, protects mice against lethal pneumonia. This finding represents the first successful vaccine strategy for the treatment of staphylococcal pneumonia.

S. aureus is a leading cause of bloodstream, skin, soft tissue, and lower respiratory tract infections worldwide (1). In developed countries such as the United States, resistance to β-lactam antibiotics in MRSA is a major problem in hospitals and other healthcare settings. In these settings, S. aureus infections are primarily caused by MRSA and typically occur in individuals with risk factors for disease, such as those who are immunocompromised or have had surgery. Notably, the incidence rate of all invasive MRSA infections, including those outside of hospitals, is high compared with other bacterial pathogens (31.3 per 100,000 individuals), and 20% of these infections result in death (2). Although bacteremia is the most prevalent condition during invasive disease caused by MRSA, pneumonia ranks second and occurs in 13.3% of all invasive infections (2).

In contrast to S. aureus infections acquired in healthcare settings, community-associated S. aureus infections, which in the United States are also caused primarily by MRSA, occur in otherwise healthy individuals. The majority of community-associated MRSA (CA-MRSA) infections are treatable infections of skin and soft tissue (3), but some infections lead to severe invasive disease (4). CA-MRSA was first reported in the late 1990s, when pneumonia was the third most prevalent syndrome, occurring in 13.5% of infected children (5). The most prevalent CA-MRSA isolate, known as USA300, accounts for up to 97% of all CA-MRSA infections (6).
Past efforts to generate an effective vaccine against S. aureus have thus far been unsuccessful. A new report by Wardenburg and Schneewind on page in this issue (7) shows that immunization with the S. aureus virulence factor Hla protects mice from an otherwise lethal S. aureus infection.

Virulence factors and immune evasionS. aureus encodes a remarkable repertoire of virulence factors. These molecules promote host colonization, facilitate evasion of the human innate immune system, and alter immune responses (for review see reference 8). For the purposes of this commentary, we will limit our discussion to a few S. aureus surface molecules, some of which have been used previously as vaccine targets.

Human neutrophils are a primary cellular defense against bacterial infections. Previous studies have shown that host opsonins, such as serum complement and antibody, play a major role in the phagocytosis of S. aureus by neutrophils (9–11). S. aureus makes several molecules, including protein A, serotype 5 or 8 capsular polysaccharide (CP5 or CP8), and clumping factor A (ClfA), which inhibit phagocytosis (12–14). But despite the bacteria's efforts to evade neutrophils, normal human serum contains a sufficient number of opsonins to promote their rapid uptake by these cells (15). The majority of clinical isolates, including USA300, encode ClfA and CP5 or CP8 (14). Because antibodies specific for CP5 or CP8 enhance phagocytosis, CP5 and CP8 have been evaluated extensively as vaccine antigens (16–18). In the end, however, S. aureus vaccines designed to enhance bacterial uptake have had limited success.

One possible reason for this outcome is the lack of correlation between uptake of the bacteria by neutrophils and their subsequent destruction. For instance, the most prominent CA-MRSA isolates survive relatively well inside neutrophils, probably in part because of their ability to resist the effects of neutrophil-derived reactive oxygen species and antimicrobial peptides (19, 20). The neutrophils, on the other hand, undergo rapid lysis after uptake of these strains (Fig. 1) (15, 21). The ability of S. aureus to survive after phagocytosis has lead some to suggest that neutrophils could be a vector for disseminating bacteria (22, 23). S. aureus can also persist inside macrophages for several days, ultimately causing the death of the cells in a process that depends on Hla (24).

Because uptake does not necessarily correlate with the killing of S. aureus, high titers of anticapsule antibodies, which facilitate uptake, may not protect against disease. This notion is not new, as it has long been known that virtually all humans have circulating antistaphylococcal antibody, and yet some still become infected (25). The idea that antibodies against the bacterial capsule may not provide protection was borne out in two unsuccessful phase III clinical trials designed to test the efficacy of active immunization against the S. aureus antigens CP5, CP8, and ClfA (26).

Hla, a pore-forming cytolytic toxin that assembles as a heptameric β-barrel structure in the plasma membrane of susceptible cells, is arguably the most widely studied S. aureus toxin (for review see reference 27). The toxin is known to cause destruction of a wide-range of host cells, including erythrocytes, epithelial cells, fibroblasts, and monocytes. Hla gained notoriety in 1928 when it was implicated in the deaths of 12 Australian children who had received a diphtheria toxoid vaccine that was later found to be contaminated with an Hla-producing S. aureus strain (27). Although anti-Hla antibody therapy was studied intensively, interest in this approach waned during the antibiotic era. S. aureus encodes numerous other extracellular cytolytic toxins, including -hemolysin, -hemolysin, Panton-Valentine leukocidin (PVL), leukocidin D/E, a leukocidin homologue (LukM/F'-PV), and the newly described phenol-soluble modulin-like peptides (28). The relative contribution of Hla to human disease as compared with these other virulence factors is not known, in part because susceptibility to Hla varies among different animal species.

A vaccine approach for treatment of S. aureus pneumonia. Until now, vaccination against Hla has not been tested in an S. aureus pneumonia model. In this issue, Wardenburg and Schneewind show that immunization against Hla prevents S. aureus pneumonia (7). The authors first show that the severity of lung disease in mice correlates with the levels of Hla produced by a particular S. aureus isolate (7). These findings are consistent with a recent study from the same group demonstrating that Hla is important for the pathogenesis of CA-MRSA pneumonia (29).
In the new study, mice were immunized with a nonpore-forming Hla variant, HlaH135L, and challenged intranasally 3 wk later, a protocol that typically induces lethal pneumonia (29). Immunization with HlaH135L protected 90–100% mice against all S. aureus strains tested (7). Vaccine-induced protection correlated directly with reduced inflammation and less severe destruction of lung tissue. Passive immunization with Hla antibody 24 h before intranasal challenge with S. aureus also protected animals against an otherwise lethal intranasal challenge with CA-MRSA or an antibiotic-sensitive S. aureus strain (7).

Antibodies against Hla also protected human lung epithelial cells from S. aureus–induced lysis (7). Although these results indicate that Hla contributes to lung tissue destruction, it is not yet clear whether the animals' death resulted from direct destruction of lung cells by the toxin, from an excessive inflammatory response, or from both. Passive transfer of Hla antibodies significantly reduced circulating levels of interleukin 1β, a cytokine known to accompany acute lung injury. Therefore, it is reasonable to conclude that the inflammatory response may contribute to Hla-mediated lung damage (Fig. 2).

A role for other toxins?

There has been considerable debate about whether another S. aureus toxin, PVL, is essential for CA-MRSA virulence. In their report, Wardenburg and Schneewind found that, unlike antibodies specific for Hla, antibodies specific for PVL did not protect mice against S. aureus pneumonia (7). This finding was consistent with an earlier study by this group, which also suggested that PVL is not required for CA-MRSA–induced pneumonia in mice (29).

This result appears to conflict with earlier data suggesting an essential role for PVL (30). But that study relied on laboratory strains of S. aureus that overexpressed PVL, thus clouding the physiological significance of these findings. Indeed, studies conducted using animal models of CA-MRSA disease have unanimously suggested that PVL is dispensable for bacterial virulence (21, 29). Recent work has, however, highlighted the potential importance of other virulence factors in CA-MRSA disease (28, 29).

Bacterial toxins as vaccine targetsThere are numerous examples of successful vaccination against bacterial toxins, including botulinum, diphtheria, and tetanus toxins. However, these toxins are known to be the primary causative agents of disease induced by their respective organisms. In contrast, S. aureus produces many toxins, and it has been generally accepted that no single S. aureus extracellular molecule can trigger disease on its own. This idea is called into question by the finding that Hla alone is required for S. aureus pneumonia (7, 29). The high level of infections caused by the S. aureus isolate USA300 and the abundance of Hla produced by this strain in vitro suggest that targeting Hla during invasive CA-MRSA infections may be a promising therapeutic approach.

AcknowledgmentsThis article was supported in part by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health.

Journal of Experimental Medicine

Vaccine protection against Staphylococcus aureus pneumonia

2008-02-16T05:51:00.000-08:00

Vaccine protection against Staphylococcus aureus pneumonia
Juliane Bubeck Wardenburg1,2 and Olaf Schneewind1
1 Department of Microbiology and 2 Department of Pediatrics, University of Chicago, Chicago, IL 60637

CORRESPONDENCE Olaf Schneewind: oschnee@bsd.uchicago.edu

Staphylococcus aureus pneumonia causes significant mortality in hospitalized or healthy individuals, and recent increases in morbidity are attributed to the rapid spread of methicillin-resistant S. aureus (MRSA) strains, which are often not susceptible to antibiotic therapy. -Hemolysin (Hla), a secreted pore-forming toxin, is an essential virulence factor of MRSA in a mouse model of S. aureus pneumonia. We show that the level of Hla expression by independent S. aureus strains directly correlates with their virulence. Active immunization with a mutant form of Hla (HlaH35L), which cannot form pores, generates antigen-specific immunoglobulin G responses and affords protection against staphylococcal pneumonia. Moreover, transfer of Hla-specific antibodies protects naive animals against S. aureus challenge and prevents the injury of human lung epithelial cells during infection. Thus, Hla vaccination or immunotherapy may prevent S. aureus pneumonia in humans.

The Journal of Experimental Medicine

A New Method for Antimicrobial Susceptibility Testing of In Vitro-cultured Bacteria By Means of Resonance Light Scattering Technique.

2008-02-03T06:22:00.000-08:00

A New Method for Antimicrobial Susceptibility Testing of In Vitro-cultured Bacteria By Means of Resonance Light Scattering Technique.
Jan 2008

Shi YJ, Chen J, Xu M.
School of Chemistry and Chemical Engineering, Nantong University, Nantong, Jiangsu 226000, P.R. China.

A new method for antimicrobial susceptibility testing of in vitro-cultured bacteria on an ordinary fluorescence spectrometer was developed. The viable bacteria reduced 3- (4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) to produce insoluble particles that displayed intense resonance scattering light (RSL). The assay showed a linear relationship between the number of viable bacteria and the intensity of resonance scattering light. Dead bacteria were unable to reduce MTT. Methicillin-resistant Staphylococcus aureus exposed to flavonoids from Marchantia convoluta showed a flavonoids concentration-dependent inhibition of the ability to reduce MTT. In the assay, less than 12 h were required to attain susceptibility results and fewer bacteria were utilized than in traditional methods.

The RLS technique could, in combination with the MTT assay, be a rapid and sensitive measuring method to determine the in vitro activity of new antimicrobials.

PMID: 18239427 [PubMed - in process]

Pneumococcal antimicrobial resistance: therapeutic strategy and management in community-acquired pneumonia.

2008-01-19T06:19:00.000-08:00

Pneumococcal antimicrobial resistance: therapeutic strategy and management in community-acquired pneumonia.
Feb 2008

Aspa J, Rajas O, de Castro FR.
1Associate Professor Universidad Autónoma de Madrid, Servicio de Neumología, Hospital Universitario de la Princesa, Madrid, Spain jaspa@separ.es , 2Associate Professor Universidad Autónoma de Madrid, Servicio de Neumología, Hospital Universitario de la Princesa, Madrid, Spain, 3Professor of Medicine Universidad de las Palmas de Gran Canaria, Servicio de Neumología, Hospital Dr Negrín, Las Palmas de Gran Canaria, Spain.

Streptococcus pneumoniae has been consistently shown to represent the most frequent causative agent of community-acquired pneumonia (CAP) and pneumococcal antibiotic resistance towards different families of antibiotics continues to be a much-debated issue. Microbial resistance causes a great deal of confusion in choosing an empirical treatment for pneumonia and this makes it necessary to know which factors actually determine the real impact of antimicrobial resistance on the outcome of pneumococcal infections.

Several different aspects have to be taken into account when analyzing this matter, such as the study design, the condition of the patient at the time of diagnosis, the choice of the initial antimicrobial regimen (combination or monotherapy) and the pharmacokinetic/pharmacodynamic variables of the chosen antibiotic.

It is generally accepted that in the treatment of beta-lactam-resistant pneumococcal infections, the use of standard antipneumococcal beta-lactam agents is unlikely to impact negatively on the outcome of CAP when appropriate agents are given in sufficient doses. As a general rule, for infections with penicillin-sensitive strains, penicillin or an aminopenicillin in a standard dosage will be effective; in the cases of strains with intermediate resistance, beta-lactam agents are still considered appropriate treatment although higher dosages are recommended; finally, infections with isolates of high-level penicillin resistance should be treated with alternative agents such as the third-generation cephalosporins or the new antipneumococcal fluoroquinolones.

In areas of high prevalence of high-level macrolide resistance, empirical monotherapy with a macrolide is not optimal for the treatment of hospitalised patients with moderate or moderately-severe CAP. Fluoroquinolones are considered to be excellent antibiotics in the treatment of pneumococcal CAP in adults, but their general recommendation has been withheld due to fears of a widespread development of resistance. Most international guidelines recommend combination therapy (beta-lactam plus a macrolide) for the treatment of hospitalised patients with CAP.

PMID: 18201146 [PubMed - as supplied by publisher]

Infections After Plastic Procedures: Incidences, Etiologies, Risk Factors, and Antibiotic Prophylaxis.

2007-12-24T04:13:00.000-08:00

Infections After Plastic Procedures: Incidences, Etiologies, Risk Factors, and Antibiotic Prophylaxis.

Aesthetic Plast Surg. 2007 Dec

Gravante G, Caruso R, Araco A, Cervelli V.
Department of General Surgery, University of Tor Vergata in Rome, Via U. Maddalena 40/a, Ciampino (Roma), 00043, Italy, ggravante@hotmail.com.

BACKGROUND: Through a review of the English literature, this study aimed to assess the incidence, etiology, risk factors, and preventive measures for postoperative infections occurring after plastic surgery operations.

METHODS: All studies describing the occurrence of infections after plastic surgery procedures including case reports, prospective trials, and retrospective series were selected.

RESULTS: The 85 articles analyzed showed that incidences differ greatly among procedures and seem to be influenced by different and specific risk factors for each operation. Etiologic agents are primarily bacteria, although mycobacteria, virus, and fungi also have been described. No agreement exists on the use of antibiotic prophylaxis, except for abdominoplasties, because few specific prospective trials are present in the literature.

CONCLUSIONS: Infections remain an important problem in plastic surgery with different points that still need to be clarified. Hopefully, in the future prospective randomized trials will definitively address this issue in order to provide plastic surgeons with clear and unbiased guidelines on its prevention and management.

Springer Link

Respiratory infections: do we ever recover?

2007-12-21T01:55:00.000-08:00

Respiratory infections: do we ever recover?

2007

Goulding J, Snelgrove R, Saldana J, Didierlaurent A, Cavanagh M, Gwyer E, Wales J, Wissinger EL, Hussell T.
B.Sc. (Hons), Kennedy Institute for Rheumatology, Imperial College London, 1 Aspenlea Road, London W6 8LH, UK. t.hussell@imperial.ac.uk.

Although the outcome of respiratory infection alters with age, nutritional status, and immunologic competence, there is a growing body of evidence that we all develop a unique but subtle inflammatory profile. This uniqueness is determined by the sequence of infections or antigenic insults encountered that permanently mold our lungs through experience. This experience and learning process forms the basis of immunologic memory that is attributed to the acquired immune system. But what happens if the pathogen is not homologous to any preceding it? In the absence of cross-specific acquired immunity, one would expect a response similar to that of a subject who had never been infected with anything before. It is now clear that this is not the case. Prior inflammation in the respiratory tract alters immunity and pathology to subsequent infections even when they are antigenically distinct. Furthermore, the influence of the first infection is long lasting, not dependent on the presence of T and B cells, and effective against disparate pathogen combinations. We have used the term "innate imprinting" to explain this phenomenon, although innate education may be a closer description. This educational process, by sequential waves of infection, may be beneficial, as shown for successive viral infections, or significantly worse, as illustrated by the increased susceptibly to life-threatening bacterial pneumonia in patients infected with seasonal and pandemic influenza. We now examine what these long-term changes involve, the likely cell populations affected, and what this means to those studying inflammatory disorders in the lung.

Full Text Article

American Thoracic Society

Asthma and atypical bacterial infection

2007-12-15T03:57:00.000-08:00

Asthma and atypical bacterial infection
Chest. 2007 Dec

Sutherland ER, Martin RJ.
National Jewish Medical and Research Center, Department of Medicine, 1400 Jackson St, J220, Denver, CO 80206. sutherlande@njc.org.

A growing body of basic and clinical science implicates the atypical bacterial pathogens Mycoplasma pneumoniae and Chlamydophila (formerly Chlamydia) pneumoniae as potentially important factors in asthma, although their exact contribution to asthma development and/or persistence remains to be determined. Evidence from human studies links both M pneumoniae and C pneumoniae to new-onset wheezing, exacerbations of prevalent asthma, and long-term decrements in lung function, suggesting that these organisms can play an important role in the natural history of asthma. Furthermore, animal models of acute and chronic infection with these organisms indicate that they have the ability to modulate allergic sensitization and pulmonary physiologic and immune response to allergen challenge. These findings raise the possibility that, in at least some individuals with asthma, antibiotic therapy might have a role in long-term treatment. While antibiotics do not currently have a defined role in the treatment of stable patients with chronic asthma, there is emerging evidence that asthma symptoms and biomarkers of airway inflammation can improve when patients who have atypical bacterial infection as a cofactor in their asthma are treated with macrolide antibiotics. Ongoing research into the importance of atypical pathogens in asthma will further elucidate whether these infections are important in disease development or whether their prevalence is increased in asthmatic subjects due to chronic airway inflammation or other, yet unidentified, predisposing factors. Current studies will further define the role of macrolide antibiotics in the treatment of stable patients with asthma, ultimately determining whether these therapeutic agents have a place in asthma management.

PMID: 18079229 [PubMed - in process]

Nosocomial Gram-positive bacterial infections in children: Results of a 7 year study.

2007-11-30T03:08:00.000-08:00

Nosocomial Gram-positive bacterial infections in children: Results of a 7 year study.

Celebi S, Hacimustafaoglu M, Ozdemir O, Ozakin C.
Department of Pediatrics, Division of Pediatric Infectious Diseases, Uludag University Medical Faculty, Gorukle, Bursa, Turkey.

Background: The aim of the present paper was to determine the rate of culture-proven nosocomial infections and evaluate the episodes of nosocomial Gram-positive (GP) bacterial infections in pediatric patients.

Methods: The data of children with positive culture, who were diagnosed as having nosocomial infection on the Centers for Disease Control and Prevention criteria, were examined and only the patients with nosocomial GP bacterial infections were included in the study.

Results: Between January 1997 and January 2004 a total of 836 episodes of nosocomial GP bacterial infections were observed. The most frequently seen nosocomial GP bacterial infections were primary bloodstream infections (BSI; 43%), ventriculoperitoneal shunt infections (18%), and nosocomial pneumonias (11%). Coagulase-negative staphylococci (CONS; 46%) were the most common nosocomial GP bacteria isolated, followed by Staphylococcus aureus (33%). Methicillin resistance rates for CONS and S. aureus were 85% and 25.2%; respectively. The mortality rate was 4% of all children with nosocomial GP bacterial infections in the present study.

Conclusion: In the present patients primary BSI were the most common nosocomial GP bacterial infections and CONS were the most frequent GP pathogen isolated. Antimicrobial resistance in GP isolates is an increasing problem.

PMID: 18045289 [PubMed - in process]

Necrotizing fasciitis in children: diagnostic and therapeutic aspects.

2007-11-22T04:23:00.000-08:00

Necrotizing fasciitis in children: diagnostic and therapeutic aspects.

J Pediatr Surg. 2007 Nov
Bingöl-Koloğlu M, Yıldız RV, Alper B, Yağmurlu A, Ciftçi E, Gökçora IH, Ince E, Emiroğlu M, Dindar H.
Department of Pediatric Surgery, Ankara University School of Medicine, Ankara 06100, Turkey.

BACKGROUND: Necrotizing fasciitis (NF) is a severe life-threatening soft tissue infection characterized by rapidly spreading necrosis of the fascia and the subcutaneous tissue. Its incidence owing to invasive Streptococcus pyogenes has significantly increased in children recently. Our experience with NF in children to describe diagnostic and therapeutic aspects is hence presented herein.

METHODS: Records of children who were treated for NF in our unit from 1999 to 2006, inclusive, were reviewed retrospectively. Information recorded for each patient included medical history, clinical characteristics, diagnostic procedures, treatment methods, and the outcome.

RESULTS: Thirteen patients with a mean age of 35 months were treated for NF during the study period. All of the 13 children had no previous immunosuppression. The predisposing factors were composed of varicella lesions, intramuscular injections, application of a cream containing menthol to the cervical region, penetrant gluteal trauma, omphalitis, dental abscess, and streptococcal toxic shock syndrome. The most common site of the initial involvement was the abdominal wall, followed by the gluteal region and thigh, head and neck, and upper and lower extremities. The initial skin presentations were induration or cellulitis and erythema and edema with progression to skin discoloration and bullae formation. Fever and tachycardia were the most common clinical features. S. pyogenes was the most common causative microorganism, followed by Staphylococcus epidermidis and Pseudomonas aeruginosa. All patients underwent extensive surgical debridement and received appropriate antibiotics and supportive therapy. Twelve patients survived, and 1 patient with delayed diagnosis of NF died of septic shock.

CONCLUSION: Although these infections are rare in children, their lethal potential and early diagnostic signs must be recognized. All children with NF should undergo early surgical debridement to prevent delay in treatment. The mortality and morbidity associated with NF in children can be decreased with clinical awareness, early diagnosis, and adequate and urgent surgical debridement followed by intensive supportive care and early wound resurfacing.

Elsevier

Drug-resistant BlaKPC may be spreading

2007-11-20T14:17:00.000-08:00

Drug-resistant BlaKPC may be spreading

Typically found in bacteria in the East Coast, the gene was recently detected in St. Louis.

by Jay LewisIDN Managing Editor

November 2007

CHICAGO – Researchers have discovered the presence of the BlaKPC gene in bacteria in patients in a St. Louis hospital. Prior to this, the gene, which enables bacteria to become resistant to several important antibiotics, was typically found in the East Coast. Researchers say this discovery may indicate that BlaKPC is gaining strength and spreading.

Jonas Marschall, MD, a fellow in infectious disease at Washington University School of Medicine in St. Louis, presented the findings at the 47th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, held in Chicago in September.

BlaKPC was first discovered in Klebsiella pneumoniae taken from patients in hospitals in New York City less than 10 years ago. Experts have remained concerned about the spread of bacteria with BlaKPC; the gene allows bacteria to be resistant to antibiotics in the carbapenem class, which are typically used to treat the most critically-ill patients. Studies have shown that the mortality rate may be as high as 50% for patients who test positive for bacteria with the BlaKPC gene.

Easily transferable

Marschall said the study indicated that BlaKPC may be easily transferable, thus indicating that its spread may continue. “It appears that this gene is located on a plasmid and can therefore be passed on to other bacteria relatively easily,” Marschall told Infectious Disease News . “Also, patients that are either infected or colonized with BlaKPC-positive bacteria may be unrecognized using standard clinical lab methods, which can allow for transmission of the bacteria to other patients.”

Marschall and his colleagues used polymerase chain reaction to isolate and amplify bacterial DNA to detect the BlaKPC gene. The researchers studied 243 samples from 223 patients with bloodstream-based bacterial infections. Four of the samples tested positive for BlaKPC.
Marschall said that although this number is small, the finding is significant because the gene is easily spread. It may be only a matter of time before rates increase.

Marschall said hospitals need to take steps to help prevent further spread of BlaKPC. However, there are many challenges.

Stopping the spread

“In general, contact isolation of a patient infected with BlaKPC-positive bacteria would prevent transmission to other patients,” Marschall said. “Isolation, however, implies detection. Detection of these bacteria is not optimal with conventional testing for antimicrobial susceptibility. Some laboratories do not test routinely for susceptibility to carbapenem antibiotics. Thus, as a first step to reduce resistance, methods for detection should be optimized.”

Marschall added that screening methods at many hospitals are inadequate. “There is no established screening method for BlaKPC-positive bacteria, in contrast to methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus,” he said. “The value of screening and the necessary tools are still being discussed in the scientific community.”

Marschall recommended that detection methods for BlaKPC should be improved. “Optimal detection methods should be further investigated, including the question of whether molecular screening tools need to be used,” he said.

Marschall also recommended that researchers investigate alternative antibiotic methods that can be used when antibiotics in the carbapenem class are ineffective. “Further studies should examine alternative treatment regimens that can be used if carbapenems fall away, including the development of new compounds with activity against gram-negative bacteria,” he said.

For more information:

Marschall J, Tibbetts R, Dunne W, et al. Presence of the KPC carbapenemase gene in Enterobacteriaceae bacteremia, correlation with carbapenem susceptibility, and the impact on clinical outcomes. #196. Presented at: the 47th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy; Sept. 17-20, 2007; Chicago.

Infectious Disease News

Erysipelas: a common potentially dangerous infection.

2007-11-15T15:24:00.000-08:00

Erysipelas: a common potentially dangerous infection.

Acta Dermatovenerol Alp Panonica Adriat. 2007 Sept

Celestin R, Brown J, Kihiczak G, Schwartz RA.
New Jersey Medical School, 185 South Orange Avenue, Newark, NJ 07103-2714, USA.

Erysipelas is an acute superficial cutaneous cellulitis that commonly occurs not only in elderly and immunocompromised persons, but also in neonates and small children subsequent to bacterial inoculation through a break in the skin barrier. Group A Beta-hemolytic streptococcus (GABHS, Streptoccocus pyogenes) is the usual etiologic agent. Factors that predispose pediatric patients to the development of erysipelas include very young age, diabetes mellitus, an immunocompromised state, and nephrotic syndrome. Patients typically have a well-demarcated, erythematous, indurated, rapidly spreading patch with a palpable advancing border on the face or extremities. Fever with chills and general malaise may be prominent symptoms. Antibiotics are usually effective. Patients handled in a timely manner tend to recover without problems. However, potential complications include abscess formation, necrotizing fasciitis, septicemia, recurrent infection, and lymphedema.

PMID: 17994173 [PubMed - as supplied by publisher]

* * * * * *

Erysipelas today

Gvozdenović E, Dulović O.

Klinicki centar Srbije, Beograd. elika@eunet.yu

INTRODUCTION: Erysipelas is a form of cellulitis and a bacterial infection affecting the most superficial layers of the skin which is caused by group A--hemolytic Streptococcus. The symptoms of erysipelas usually arise quite suddenly and they are often accompanied by fever, chill and shivering. The affected skin is distinguished from other forms of cellulitis by well-defined, raised edge. The affected skin is red, swollen and may be finely dimpled (like an orange skin).

TREATMENT OF ERYSIPELAS: Uncomplicated erysipelas can be treated on an outpatient basis. Indications for hospitalization include a severe clinical picture and socioeconomics factors. Most patients suffering from erysipelas in Belgrade are treated at the Institute of Infectious and Tropical Diseases, and the aim of this study was to analyze patients treated during 2002 and 2003, in order to determine characteristics of erysipelas at the beginning of the XXI century.

MATERIAL AND METHODS: During the studied period, we treated 60 patients (26.7%) of all registrated erysipelas cases in Belgrade. The male/female ratio was 1:1.6.

DISCUSSION AND CONCLUSION: Prevalence was higher during the summer months. In most cases, the severity and the need for hospitalization were recognized at the beginning; therefore, 74% of patients were hospitalized during the first five days from the onset of nonspecific signs of illness. Laboratory tests showed mild leukocytosis (med 12.05 x 10/9/l), with predominant neutrophils (74.8%) and increased fibrinogen (med 5.4 g/l). Predisposing factors were present in 83.3% of cases; of them, in 35% of cases this was not the first episode of this illness. In 85% of cases erysipelas of the leg was established, and it was the most frequent localization of all.

PMID: 17988064 [PubMed - in process]

Bacterial dermohypodermitis: a retrospective single-center study of 244 cases in Guinea

2007-11-07T03:11:00.000-08:00

Bacterial dermohypodermitis: a retrospective single-center study of 244 cases in Guinea

Ann Dermatol Venereol. 2007 Oct

Cisse M, Keïta M, Toure A, Camara A, Machet L, Lorette G.
Dermatologie-MST, CHU Donka, CHU Ignace Deen, Conakry, Guinée.

BACKGROUND: Dermo-hypodermal bacterial infections (erysipelas, cellulitis and necrotizing fasciitis) are frequent and may be life-threatening.

PATIENTS AND METHODS: A retrospective study of a period of 4 years and 6 months (1 June 1999 to 31 December 2003) was carried out at the Donka University Hospital centre (Conakry-Guinea) in order to analyze the epidemiological, clinical and therapeutic characteristics of bacterial dermohypodermitis in a hospital environment.

RESULTS: Two hundred and forty-four patients (188 women and 56 men) were hospitalized for bacterial dermohypodermitis. Mean age was 38 years. The site of dermohypodermitis comprised the entire lower limbs in 4 cases (2%), legs and feet in 200 cases (82%), thighs in 12 cases (4%), buttocks in 4 cases (2%) and upper limbs in 24 cases (10%). A previous history of dermohypodermitis, chronic alcoholism, use of non-steroidal anti inflammatory drugs, obesity and lymphoedema was identified. Necrotizing bacterial dermohypodermitis and necrotizing fasciitis were the main complications and were seen in 31 patients. These conditions were generally associated with use of non-steroidal anti inflammatory drugs (90% vs. 25%) (OR=27, CI 95=8-94), delayed initiation of suitable treatment and use of traditional medicine.

CONCLUSION: Our study shows female predominance of bacterial dermohypodermitis. This is explained by cutaneous atrophy in women resulting from use of depigmenting drugs that facilitate skin breaks, thus allowing ingress of bacteria. NSAID intake, while frequent in our series, was far higher in the fasciitis group, suggesting a potentially aggravating role of these drugs.

Masson

Dangerous bacterial infections are on the rise

2007-11-03T09:48:00.000-07:00

Dangerous bacterial infections are on the rise
What you can do to counter the trend and stay safe.

November 2007
When conducting hospital rounds a few months ago, Neil Fishman, M.D., saw five patients whose infections didn’t respond to any available antibiotic. “I was shocked,” says Fishman, an expert in antibiotic resistance with the Infectious Diseases Society of America in Arlington, Va. “I fear we’re at a tipping point--on the verge of returning to a pre-antibiotic era, when none of our antibiotics may work at all.”

Most bacterial infections can still be treated with at least one antibiotic. But there are emerging problems. For example:

Nearly 1 of every 3 pneumococci--the bacteria responsible for many pneumonias--has become resistant to penicillin, and 1 in 10 is resistant to most other antibiotics.

An antibiotic-resistant strain of staphylococcus that triggers potentially deadly lung and bloodstream infections is spreading through hospitals in this country and, increasingly, into communities.

Few if any antibiotics work against a bacterium called Acinetobacter baumannii, which has infected the wounds of many soldiers returning home from Iraq and Afghanistan, in some cases forcing doctors to amputate infected limbs.

Gonorrhea and tuberculosis are making a comeback, in part because the bugs responsible for them have developed defenses against previously used antibiotics.

Consumers have contributed to the growing crisis by not taking antibiotics properly and, in many cases, insisting that their doctor prescribe antibiotics for viral infections, such as the flu, ear infections, and the common cold, even though antibiotics work only against bacterial infections.

Doctors have made the situation worse by acquiescing to those ill-informed requests and, when antibiotics are required, sometimes prescribing the wrong dose, the wrong schedule, or the wrong medication. For example, recent research suggests that doctors often turn to newer, more powerful antibiotics when older ones would suffice. And some doctors use antibiotics for even more controversial purposes, such as the long-term treatment of Lyme disease or rheumatoid arthritis.

In hospitals, the combination of drug misuse and poor hygiene has brought the problem of antibiotic resistance to a crisis. Almost 5 percent of all hospitalized patients now acquire an infection during their stay; nearly 100,000 of them die each year as a result.

Here are some steps you can take in your home, your doctor’s office, and in the hospital to protect yourself from antibiotic-resistant bacteria.

SAFE AT HOME

The more an antibiotic is used as a drug and, to a lesser extent, in animal feed and possibly even household cleaners and other consumer products, the more opportunity bacteria have to adapt to it. Using the wrong drug dose or the wrong medication to treat infection can also breed resistance by allowing some bugs to survive, develop resistance, and multiply. So the key to combating antibiotic resistance is preventing unnecessary and inappropriate antibiotic use--tasks that start at home.

Don’t self-treat. Don’t use your own or other people’s leftover antibiotics to treat a self-diagnosed infection, since the drug may not be right for your current infection--if you have one. And don’t order antibiotics online without a prescription, since you might get the wrong drug, the wrong dose, or even a counterfeit product.

Use antibiotic creams sparingly. These over-the-counter products, such as neomycin (Mycitracin, Neosporin, and generic), are needed only for cuts that leave visible dirt or grit behind. In most other cases, washing the wound thoroughly with regular soap and water will provide all the protection you need.

Avoid “antibacterial” products. Soaps with the germ-killing ingredient triclosan don’t prevent infections when used at home, research suggests. Other antibacterial products, including deodorants, wipes, and cleaning products, probably don’t either. But their widespread use may make antibacterial soaps less effective for people who really need them, such as hospital and nursing-home staff. Prevent infection at home by washing hands with plain soap and water or an alcohol-based product like Purell.

Dispose of old antibiotics properly. Researchers have now detected antibiotics in the water supply, possibly from agricultural runoff, excretion from bodies, or old antibiotics dumped into toilets or thrown into landfills, where they may leach into rivers or the groundwater. So if you have old antibiotics in your medicine cabinet, take them to your pharmacist, who can give you advice on the best way to get rid of the drugs and may even participate in a medication-disposal program.

Consider purchasing certified-organic meat. Organic chicken, beef, and other meat don’t necessarily harbor fewer bacteria-resistant germs than regular meat, recent Consumer Reports tests have shown. And organic meat typically costs more. But at least animals raised organically haven’t been fed antibiotic-laced feed, and organic meat hasn’t been treated with antibiotics. So purchasing organic meat can help reduce the spread of antibiotics in the environment.

WORK WITH YOUR DOCTOR

Doctors know that antibiotics work only against bacteria, not viruses. But they often prescribe the drugs for likely viral infections “just to be safe” or to satisfy an insistent patient. So don’t expect or accept antibiotics for common respiratory-tract infections.

Even when you do require antibiotics, your doctor might not prescribe them appropriately. Here’s how to prevent those mistakes.

Get tested. Expect your doctor to check a blood count or take a culture of the infected tissue or fluid. That will help confirm the diagnosis of a bacterial infection before your doctor prescribes an antibiotic, and will help in matching the drug to the bug.

Fight it off. If you have only a mild infection, ask if you can delay treatment for a few days to see if your body can fight it off.

Consider short courses. Ask whether a brief course of antibiotics--such as the three-day plan advised for simple urinary tract infections--can clear the infection. (That approach should be tried only when studies have proved that short courses eliminate the infection.)

Ask about targeted drugs. “Narrow-spectrum” antibiotics that target the likely bacteria are usually better choices than broad-spectrum ones, which can trigger multiple resistances simultaneously. Those medications are often cheaper, too.

Take as directed.Many people stop taking antibiotics once they start feeling better. But unless you finish the course, some of the responsible bacteria will probably survive and perhaps adapt to the medication. So take all the antibiotic pills your doctor prescribes.

Be leery of preventive and long-term use. Doctors sometimes prescribe antibiotics to ward off recurrent urinary tract infections or before dental surgery. But such preventive use is appropriate only if self-help measures and short courses of antibiotics don’t work, or if you’re at high risk of a dental infection spreading to your heart because, for example, you have an artificial heart valve or certain congenital defects.

Some doctors prescribe antibiotics for months or even years to treat Lyme disease or rheumatoid arthritis. But recent guidelines for Lyme disease emphasize that two to four weeks of treatment usually provides maximum benefits. And though some evidence suggests that tetracycline antibiotics may help certain people with rheumatoid arthritis, researchers say that’s not because the disease is caused by an infection but because the drugs may interfere with certain cartilage-destroying enzymes. More important, that benefit appears small, especially compared with the success of other arthritis drugs now available.

BUG-FREE IN THE HOSPITAL

Surgical procedures, needles, and catheters can carry bugs into the body. And hospital staff may fail to take the necessary steps to stop the spread of infection. To cut your risk of contracting or inadvertently spreading an infection while in a hospital or nursing home:

Insist on clean hands. Expect everyone who touches you to first wash their hands with soap or an alcohol-based solution. If you don’t see them do that, politely ask them to. And ask doctors and nurses to clean their stethoscopes, too, since studies show that they seldom clean those instruments between patients.

Don’t swallow bacteria.Keep your hands away from your eyes, nose, and mouth, and don’t set food or utensils directly on tables or beds.

Monitor antibiotic use. Hospital patients are too often given antibiotics plus an acid-suppressing heartburn drug. That combination of drugs can allow invading bacteria to colonize in the gut and sometimes triggers hard-to-treat infections. Before some kinds of surgery, on the other hand, antibiotics may be underused. Ask your doctor if your operation poses a significant threat of infection and if you should receive a single dose of an appropriate antibiotic in the hour beforehand.

Ask about your catheter. The risk of catheter-associated urinary-tract infections increases the longer the catheter remains in place. So if you’re still using a catheter 48 hours after surgery, find out whether your nurse or your doctor has forgotten to remove it.

Choose your hospital. Ask your doctor or surgeon if he or she knows the infection rates for hospitals in your area and, if possible, ask to be admitted to the one with the lowest rate. The hospital-infection initiative Stop Hospital Infections of Consumers Union, the publisher of this newsletter, offers information on the roughly 20 states that now require hospitals to make infection rates public, and what you can do to help make other states take the same step.

PROTECT YOURSELF FROM STAPH INFECTIONS AT THE GYM

A strain of the bacterium methicillin-resistant Staphylococcus aureus (MRSA) has spread from hospitals into communities, mostly in gyms and health clubs, where people unknowingly share contaminated towels or athletic equipment. While the strain is less deadly than the version found in hospitals, it's now a leading cause of skin-related visits to the emergency room. To protect yourself, don't share towels, put a clean towel over workout mats, and wipe down equipment with the alcohol spray that most gyms provide. And see your doctor if you have signs of skin infection: boils or a localized, painful rash that doesn't heal.

Consumer Reports

Household contacts were key factor for children's colonization with resistant Escherichia coli in community setting.

2007-11-02T22:21:00.000-07:00

Household contacts were key factor for children's colonization with resistant Escherichia coli in community setting.
Lietzau S, Raum E, von Baum H, Marre R, Brenner H.
Department of Epidemiology, German Centre for Research on Ageing, Heidelberg, Germany.

Keywords: Antibiotic resistance, Bacterial, E. coli, Children, Household, Transmission

OBJECTIVE: In young children infections with resistant Escherichia coli (E. coli) can lead to life-threatening situations. Epidemiological data on the prevalence and major determinants of carriage of antibiotic resistant E. coli among children in the community setting are sparse.

STUDY DESIGN AND SETTING: In a population-based study from Germany, stool samples were obtained from children aged 6 months to 4 years attending a pediatrician for a regular health screening (N=568) or an acute infection (N=316), as well as from their parents (N=1,594) and siblings (N=624). E. coli was cultured, and minimal inhibitory concentrations to various antibiotics were tested. We determined prevalences of E. coli resistance to commonly prescribed antibiotics and their association with potential risk factors.

RESULTS: Prevalence of E. coli resistance was 16.6%, 8.7%, and 11.6% for ampicillin, cotrimoxazole, and doxycycline, respectively. Strong associations were found with antibiotic resistance among siblings (odds ratios [95% confidence intervals] for ampicillin, doxycycline, and cotrimoxazole resistance: 4.4 [1.8-10.8], 8.0 [3.0-21.2], and 10.8 [3.5-32.7], respectively).

CONCLUSION: Resistance prevalences in this community-based study were much lower than those reported from the clinical sector. Household contacts seem to be the key factor for children;s colonization with resistant E. coli in the community setting.

J Clin Epidemiol. 2007 Nov

Differential diagnosis between viral and bacterial meningitis in children.

2007-11-01T16:47:00.000-07:00

Differential diagnosis between viral and bacterial meningitis in children.

Eur J Emerg Med. 2007 Dec

De Cauwer HG, Eykens L, Hellinckx J, Mortelmans LJ.

aDepartment of Neurology bClinical Laboratory Departments of cPaediatrics dEmergency Medicine, Klina Regional Hospital, Brasschaat, Belgium.

OBJECTIVE: The differential diagnosis between viral meningitis and bacterial meningitis is often very difficult. The results of peripheral blood and spinal fluid analysis are not 100% accurate. We tried to find a useful 'bedside' decision-making tool, based on laboratory results readily available at the emergency department. METHODS: Retrospective study design. Analysis of a consecutive series of all children (age 0-15 years) admitted to the paediatric ward because of a viral or bacterial meningitis, in the period from 1997 to September 2005.

RESULTS: Seventy-one children with viral and 21 with bacterial meningitis were included. Bacterial meningitis occurred at much younger ages than viral meningitis. The paediatrician decided to administer antibiotics in 41 of 71 children with viral meningitis and in all children with bacterial meningitis. We developed a 'bacterial meningitis score' based on C-reactive protein in peripheral blood, as well as glucose and protein in cerebrospinal fluid. Using this score, we could distinguish 54 of 71 patients with viral meningitis from the group with bacterial meningitis. When the dispensing of antibiotics was based on this score, only 16 patients with viral meningitis would receive antibiotics.

CONCLUSION: We present a bedside bacterial meningitis score. Using this bacterial meningitis score as a decision-making tool, we would be able to avoid antibiotics in a large number of children with viral meningitis. As this gives a 100% success rate, thus guaranteeing that bacterial meningitis patients would receive the proper therapy, our bacterial meningitis score could be an accurate decision-support tool.

Emergency Medicine

Childhood asthma after bacterial colonization of the airway in neonates.

2007-10-22T10:04:00.000-07:00

Childhood asthma after bacterial colonization of the airway in neonates.

N Engl J Med. 2007 Oct 11

Danish Pediatric Asthma Center, Copenhagen University Hospital, Gentofte, Copenhagen. bisgaard@copsac.dk

BACKGROUND: Pathological features of the airway in young children with severe recurrent wheeze suggest an association between bacterial colonization and the initiating events of early asthma. We conducted a study to investigate a possible association between bacterial colonization of the hypopharynx in asymptomatic neonates and later development of recurrent wheeze, asthma, and allergy during the first 5 years of life.

METHODS: The subjects were children from the Copenhagen Prospective Study on Asthma in Childhood birth cohort who were born to mothers with asthma. Aspirates from the hypopharyngeal region of asymptomatic 1-month-old infants were cultured for Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Staphylococcus aureus. Wheeze was monitored prospectively on diary cards during the first 5 years of life. Blood eosinophil count and total IgE and specific IgE were measured at 4 years of age. Lung function was measured and asthma was diagnosed at 5 years of age.

RESULTS: Hypopharyngeal samples were cultured from 321 neonates at 1 month of age. Twenty-one percent of the infants were colonized with S. pneumoniae, M. catarrhalis, H. influenzae, or a combination of these organisms; colonization with one or more of these organisms, but not colonization with S. aureus, was significantly associated with persistent wheeze (hazard ratio, 2.40; 95% confidence interval [CI], 1.45 to 3.99), acute severe exacerbation of wheeze (hazard ratio, 2.99; 95% CI, 1.66 to 5.39), and hospitalization for wheeze (hazard ratio, 3.85; 95% CI, 1.90 to 7.79). Blood eosinophil counts and total IgE at 4 years of age were significantly increased in children colonized neonatally with S. pneumoniae, M. catarrhalis, H. influenzae, or a combination of these organisms, but specific IgE was not significantly affected. The prevalence of asthma and the reversibility of airway resistance after beta2-agonist administration at 5 years of age were significantly increased in the children colonized neonatally with these organisms as compared with the children without such colonization (33% vs. 10% and 23% vs. 18%, respectively).

CONCLUSIONS: Neonates colonized in the hypopharyngeal region with S. pneumoniae, H. influenzae, or M. catarrhalis, or with a combination of these organisms, are at increased risk for recurrent wheeze and asthma early in life.

Copyright 2007 Massachusetts Medical Society.

Bacterial communications in implant infections: A target for an intelligence war.

2007-10-08T02:39:00.000-07:00

Bacterial communications in implant infections: A target for an intelligence war.

Int J Artif Organs. 2007 Sep

Costerton JW, Montanaro L, Arciola CR.
Center for Biofilms, School of Dentistry, University of Southern California, Los Angeles, California - USA.

The status of population density is communicated among bacteria by specific secreted molecules, called pheromones or autoinducers, and the control mechanism is called ""quorum-sensing"". Quorum-sensing systems regulate the expression of a panel of genes, allowing bacteria to adapt to modified environmental conditions at a high density of population. The two known different quorum systems are described as the LuxR-LuxI system in gram-negative bacteria, which uses an N-acyl-homoserine lactone (AHL) as signal, and the agr system in gram-positive bacteria, which uses a peptide-tiolactone as signal and the RNAIII as effector molecules.

Both in gram-negative and in gram-positive bacteria, quorum-sensing systems regulate the expression of adhesion mechanisms (biofilm and adhesins) and virulence factors (toxins and exoenzymes) depending on population cell density. In gram-negative Pseudomonas aeruginosa, analogs of signaling molecules such as furanone analogs, are effective in attenuating bacterial virulence and controlling bacterial infections. In grampositive Staphylococcus aureus, the quorum-sensing RNAIII-inhibiting peptide (RIP), tested in vitro and in animal infection models, has been proved to inhibit virulence and prevent infections.

Attenuation of bacterial virulence by quorum-sensing inhibitors, rather than by bactericidal or bacteriostatic drugs, is a highly attractive concept because these antibacterial agents are less likely to induce the development of bacterial resistance.

PMID: 17918119 [PubMed - in process]

Severe skin and soft tissue infections and associated critical illness.

2007-09-26T04:57:00.000-07:00

Severe skin and soft tissue infections and associated critical illness.
Curr Infect Dis Rep. 2007 Sep

Vinh DC, Embil JM.
Infection Prevention and Control Unit, Health Sciences Centre, MS 673-820 Sherbrook Street, Winnipeg, Manitoba, R3A 1R9, Canada. jembil@hsc.mb.ca.

Skin and soft tissue infections (SSTIs) span a broad spectrum of clinical entities from limited cellulitis to rapidly progressive necrotizing fasciitis, which may be associated with septic shock or a toxic shock-like syndrome. These infections may be the primary instigators of critical illness requiring hospitalization and management in the intensive care unit. Alternatively, these infections may arise from metastatic spread of microorganisms from a distant focus. Regardless of the source, SSTIs may lead to critical illness.

The complex interplay of environment, host, and pathogen are important to consider when evaluating SSTIs and planning therapy. This second of a two-part review focuses on severe SSTIs due to Clostridium spp, microorganisms associated with water sources, and polymicrobial/mixed infections.

The key to a successful outcome is early identification of risk factors for specific pathogens and early initiation of empiric antimicrobial therapy. For some SSTIs, surgical intervention for diagnosis and/or therapy is also required.

PMID: 17880853 [PubMed - in process]

The role of biofilms in otolaryngologic infections: update 2007.

2007-09-12T18:50:00.000-07:00

The role of biofilms in otolaryngologic infections: update 2007.
Post JC, Hiller NL, Nistico L, Stoodley P, Ehrlich GD.

aCenter for Genomic Sciences, Allegheny Singer Research Institute, Pittsburgh, Pennsylvania, USA bPediatric Otolaryngology, Allegheny General Hospital, Pittsburgh, Pennsylvania, USA cDepartment of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania, USA.

PURPOSE OF REVIEW: Biofilms have been shown to play a role in otitis media, sinusitis, cholesteatoma, tonsillitis, adenoiditis, and device infections. This article is written to review recent advances in the field.

RECENT FINDINGS: The role of biofilms in the persistence of chronic, mucosal-based ENT-related infections was first recognized in otitis media. Definitive proof was lacking until the demonstration of bacterial biofilms on the middle-ear mucosa of children, not only with chronic otitis media with effusion, but also with recurrent otitis media. Strains of Pseudomonas aeruginosa isolated from cholesteatoma are avid biofilm formers. Biofilms have been reported in the adenoids of children with chronic rhinosinusitis, helping to explain the clinical observation that adenoidectomy can be beneficial to children with chronic otitis or chronic rhinosinusiti. Additional studies have confirmed the presence of biofilms in chronic tonsillitis. Biofilms have also been shown to be involved in infected cochlear implants and tracheotomy tubes.

SUMMARY: The recognition that chronic otolaryngologic bacterial infections are biofilm related has been the impetus for the development of new technologies for the study of biofilms and their prevention and treatment. Understanding that chronic bacterial infections are biofilm related is fundamental to developing rationale strategies for treatment and prevention.

Lippincott, Williams, Wilkins