Saturday, November 22, 2008
Bacterial contamination of surgeons gloves during shunt insertion: a pilot study
Br J Neurosurg. 2008 Oct
Sørensen P, Ejlertsen T, Aaen D, Poulsen K.
Department of Neurosurgery and Department of Clinical Microbiology, University Hospital of Aalborg, Denmark.
Bacterial infection is a major cause of shunt dysfunction. It is well-known that the majority of pathogenic micro-organisms are low-virulent bacteria normally found on intact skin. Probably shunts become contaminated during surgery either by contact to the patient skin, or contact from contaminated gloves or instruments. This study was performed to find out to what extent gloves become contaminated during shunt surgery. Gloves used during shunt implantation were examined in 10 operations. Shunt implantation was done using recommended precautions to avoid infection, including prophylactic antibiotics and double gloving, by surgeons experienced in shunt surgery. Surgical incision, dissection and tunnelling were done. Then the surgeon, the scrub-nurse and, in three cases, the assistant made an imprint of their outer gloves on agar plates. Hereafter, they changed the outer pair of gloves before handling the shunt and completing the operation. The plates were cultured for 6 days in both aerobic and anaerobic environment. In all cases the surgeons gloves were contaminated, and in six cases also the nurses' gloves were contaminated, as well as all three assistants. Propionebacterium acnes were cultured from gloves in all 10 operations and coagulase-negative Staphylococci were found in eight operations. These results are preliminary, but nevertheless they are alarming. Despite the use of recommended precautions to avoid infections we found that a substantial numbers of gloves from surgeon, scrub nurse and assistant were contaminated with micro-organisms less than 15 min after surgery has been commenced and before the shunts were handled. This study offers a feasible, simple and logical explanation of how shunts may become contaminated and infected. A simple measure would be to change the outer pairs of gloves before handling of the shunt material during surgery, as was done in this study, where non-shunt infections were observed.
Informaworld
Labels: coagulase-negative staphylococci, Hydrocephalus; infection, Propionebacterium acnes, shunt, surgery
Surgical site infections: epidemiology, microbiology and prevention.
J Hosp Infect. 2008 Nov
Owens CD, Stoessel K.
Kimberly-Clark Healthcare, Atlanta, GA, USA.
Surgical site infections (SSIs) are defined as infections occurring up to 30 days after surgery (or up to one year after surgery in patients receiving implants) and affecting either the incision or deep tissue at the operation site. Despite improvements in prevention, SSIs remain a significant clinical problem as they are associated with substantial mortality and morbidity and impose severe demands on healthcare resources. The incidence of SSIs may be as high as 20%, depending on the surgical procedure, the surveillance criteria used, and the quality of data collection. In many SSIs, the responsible pathogens originate from the patient's endogenous flora. The causative pathogens depend on the type of surgery; the most commonly isolated organisms are Staphylococcus aureus, coagulase-negative staphylococci, Enterococcus spp. and Escherichia coli. Numerous patient-related and procedure-related factors influence the risk of SSI, and hence prevention requires a 'bundle' approach, with systematic attention to multiple risk factors, in order to reduce the risk of bacterial contamination and improve the patient's defences. The Centers for Disease Control and Prevention guidelines for the prevention of SSIs emphasise the importance of good patient preparation, aseptic practice, and attention to surgical technique; antimicrobial prophylaxis is also indicated in specific circumstances. Emerging technologies, such as microbial sealants, offer the ability to seal and immobilise skin flora for the duration of a surgical procedure; a strong case therefore exists for evaluating such technologies and implementing them into routine clinical practice as appropriate.
PMID: 19022115 [PubMed - as supplied by publisher]
Labels: coagulase-negative staphylococci, Enterococcus spp, epidemiology, escherichia coli, microbiology, prevention, Staphylococcus aureus, Surgical site infections
Wednesday, November 12, 2008
Security swipe cards and scanners are a potential reservoir for hospital-acquired infection.
Ann R Coll Surg Engl. 2008 Nov 4
Sultan M, Alm A, Hindmarsh A, Greatorex R.
INTRODUCTION Hospital-acquired infections complicate 10% of hospital admissions resulting in increased morbidity, mortality and cost to hospitals. Most hospitals issue doctors with plastic swipe cards that function as electronic keys to access clinical areas. The card is handled many times a day, often before direct patient contact. The aim of this study was to determine if swipe cards harbour potentially harmful bacteria.
SUBJECTS AND METHODS On a single day, doctors working in the surgical directorate completed a questionnaire to determine their pattern of swipe card use. Cards were inoculated onto agar plates and incubated for 48 h under standard laboratory conditions, following which the number of colony forming units (CFUs) cultured from each card was determined. Representative colonies were sampled and sub-cultured for staphlococcal, enterococcal, coliform and pseudomonad species. Isolated bacterial pathogens were tested for antimicrobial sensitivity. Swipe-card scanners were swabbed for microbiological culture on the same day.
RESULTS All cards were colonised with environmental bacteria (mean, 73 CFU). Of cards, 21% were contaminated with pathogenic bacteria including Staphylococcusaureus (5.1%), Pseudomonasputida (2.6%), and coliformspecies (12.8%). The pattern of card use did not significantly affect the amount of bacterial contamination, but infrequent use of the card and keeping the card in a pocket or wallet was associated with higher levels of contamination. Environmental bacteria were cultured from 88% of card scanners, the highest counts coming from scanners in main theatres and the day-surgery unit.
CONCLUSIONS Doctors' swipe cards are contaminated with, and may therefore be a reservoir for, pathogenic bacteria implicated in hospital-acquired infection.
IngentaConnect
Labels: coliformspecies, hospital acquired infection, pathogenic bacteria, Pseudomonasputida, scanners, Security swipe cards, Staphylococcusaureu
Tuesday, November 04, 2008
Rapid detection and quantification of Propionibacteriaceae
Br J Ophthalmol. 2008 Oct 31
Goldschmidt P, Mora Ferreria C, Degorge S, Benallaoua D, Boutboul S, Laroche L, Batellier L, Chaumeil C.
France.
Introduction: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Today's methods of diagnosis for Propioni are unsatisfactory due to lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties for interpretation of SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). Material and methods: DNA was extracted using the MagNA Pure(R) isolation kit (Roche) and bacterial detection and quantification was carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). PCR cycling program consisted in one cycle at 95 degrees C, 20 sec and 45 cycles at 95 degrees C, 3 sec and 30 sec at 60 degrees C. DNA extraction yields were assessed in the same tube.
RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in PBS, aqueous humor, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humor and human cells in less of 1.30 h.
PMID: 18977791 [PubMed - as supplied by publisher]
Labels: anaerobic bacteria, corneal ulcers, DNA, endophthalmitis, MagNA Pure(R) isolation kit, Propioni, Propionibacteriaceae
