Tuesday, November 04, 2008

 

Rapid detection and quantification of Propionibacteriaceae

Rapid detection and quantification of Propionibacteriaceae
Br J Ophthalmol. 2008 Oct 31

Goldschmidt P, Mora Ferreria C, Degorge S, Benallaoua D, Boutboul S, Laroche L, Batellier L, Chaumeil C.
France.

Introduction: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Today's methods of diagnosis for Propioni are unsatisfactory due to lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties for interpretation of SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). Material and methods: DNA was extracted using the MagNA Pure(R) isolation kit (Roche) and bacterial detection and quantification was carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). PCR cycling program consisted in one cycle at 95 degrees C, 20 sec and 45 cycles at 95 degrees C, 3 sec and 30 sec at 60 degrees C. DNA extraction yields were assessed in the same tube.

RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in PBS, aqueous humor, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humor and human cells in less of 1.30 h.

PMID: 18977791 [PubMed - as supplied by publisher]

Labels: , , , , , ,


This page is powered by Blogger. Isn't yours?