Reducing bias in bacterial community analysis of lower respiratory infections.
Nov 2012
Rogers GB, Cuthbertson L, Hoffman LR, Wing PA, Pope C, Hooftman DA, Lilley AK, Oliver A, Carroll MP, Bruce KD, van der Gast CJ.
Source
Molecular Microbiology Research Laboratory, Institute of Pharmaceutical Science, King's College London, London, UK.
Abstract
High-throughput pyrosequencing and quantitative PCR (Q-PCR) analysis offer greatly improved accuracy and depth of characterisation of lower respiratory infections. However, such approaches suffer from an inability to distinguish between DNA derived from viable and non-viable bacteria. This discrimination represents an important step in characterising microbial communities, particularly in contexts with poor clearance of material or high antimicrobial stress, as non-viable bacteria and extracellular DNA can contribute significantly to analyses. Pre-treatment of samples with propidium monoazide (PMA) is an effective approach to non-viable cell exclusion (NVCE). However, the impact of NVCE on microbial community characteristics (abundance, diversity, composition and structure) is not known. Here, adult cystic fibrosis (CF) sputum samples were used as a paradigm. The effects of PMA treatment on CF sputum bacterial community characteristics, as analysed by pyrosequencing and enumeration by species-specific (Pseudomonas aeruginosa) and total bacterial Q-PCR, were assessed. At the local community level, abundances of both total bacteria and of P. aeruginosa were significantly lower in PMA-treated sample portions. Meta-analysis indicated no overall significant differences in diversity; however, PMA treatment resulted in a significant alteration in local community membership in all cases. In contrast, at the metacommunity level, PMA treatment resulted in an increase in community evenness, driven by an increase in diversity, predominately representing rare community members. Importantly, PMA treatment facilitated the detection of both recognised and emerging CF pathogens, significantly influencing 'core' and 'satellite' taxa group membership. Our findings suggest failure to implement NVCE may result in skewed bacterial community analyses.
Labels: bacterial community analyses, cystic fibrosis, DNA, lower respiratory infections, NVCE, PCR, Pseudomonas aeruginosa
# posted by Pat O'Connor @ 8:34 AM
Real-life 'Contagion' uses DNA to halt outbreak
August 2012
By Sharon Begley - Reuters
NEW YORK — If Hollywood needs a plot for a medical thriller, scientists at the National Institutes of Health have one: Doctors, using cutting-edge technology called whole-genome sequencing, trace an outbreak of a deadly bacterial infection, identify precisely how it's spreading - and in the final minutes sic poison-spewing robots on the rampaging microbes.
That's essentially what scientists did when Klebsiella pneumoniae, an often-lethal bacterium, spread through NIH's research hospital in Bethesda, Maryland last year, as described in a study published on Wednesday in the journal Science Translational Medicine.
"With whole-genome sequencing," said microbial geneticist Julie Segre of NIH's National Human Genome Research Institute, who led the study, "we were able to understand how the outbreak was moving through the hospital and identify weaknesses" in infection-control practices, finally halting the outbreak.
The unprecedented effort to use genome sequencing to save patients from an infectious outbreak offers hope that the technique could fight other hospital-acquired infections. These infections kill some 99,000 people die from such infections in the United States every year, estimates the U.S. Centers for Disease Control and Prevention. The added health-care costs, according to the CDC: $4.5 billion a year.
Calling it a "compelling story," virologist and microbe hunter Ian Lipkin of Columbia University in New York City said the NIH scientists' feat shows what ultra-fast whole-genome sequencing can accomplish in so-called microbial forensics. In whole-genome sequencing, machines identify the DNA units that make up an organism's entire genome.
Researchers were able "to implicate 'Patient Zero,' track transmission of a drug-resistant bacterium over the course of an important outbreak and provide insights that will inform infection control and patient care," said Lipkin, director of the Center for Infection and Immunity at Columbia's Mailman School of Public Health and a scientific adviser on the 2011 film "Contagion."
The outbreak at NIH's hospital began last summer. In June a 43-year-old patient with antibiotic-resistant K. pneumoniae, which infects the urinary tract and bloodstream and can cause sepsis, a blood infection, was transferred to its intensive-care unit from a New York City hospital. "Patient Zero" was put in an isolation room; staff and visitors had to wear gowns, masks and gloves to enter.
Labels: bacterial infection, bloodstream, DNA, genome sequencing, hospital-acquired infections, K. pneumonia, microbes, sepsis, urinary tract
# posted by Pat O'Connor @ 10:40 AM
Rapid detection and quantification of Propionibacteriaceae Br J Ophthalmol. 2008 Oct 31
Goldschmidt P, Mora Ferreria C, Degorge S, Benallaoua D, Boutboul S, Laroche L, Batellier L, Chaumeil C.
France.Introduction: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Today's methods of diagnosis for Propioni are unsatisfactory due to lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties for interpretation of SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). Material and methods: DNA was extracted using the MagNA Pure(R) isolation kit (Roche) and bacterial detection and quantification was carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). PCR cycling program consisted in one cycle at 95 degrees C, 20 sec and 45 cycles at 95 degrees C, 3 sec and 30 sec at 60 degrees C. DNA extraction yields were assessed in the same tube.
RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in PBS, aqueous humor, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humor and human cells in less of 1.30 h.
PMID: 18977791 [PubMed - as supplied by publisher]
Labels: anaerobic bacteria, corneal ulcers, DNA, endophthalmitis, MagNA Pure(R) isolation kit, Propioni, Propionibacteriaceae
# posted by Pat O'Connor @ 5:10 AM
